Circulating dipeptidyl peptidase-4 is independently associated with the presence and severity of NAFLD/NASH in individuals with and without obesity and metabolic disease

Circulating dipeptidyl peptidase-4 is independently associated with the presence and severity of NAFLD/NASH in individuals with and without obesity and metabolic disease

December 22, 2020 0 By Keith
Introduction: Dipeptidyl peptidase 4 (DPP4) ranges are related to metabolic and cardiovascular illnesses in people; preliminary proof reported a relationship between DPP4 and continual liver illnesses. Intention of this examine was to research hepatic and systemic DPP4 ranges/exercise in relation to NAFLD/NASH in people with and with out metabolic illness.
Strategies: We recruited fifty-two overweight people present process bariatric surgical procedure and intra-operative liver biopsy at Sapienza College, Rome, Italy. The affiliation between DPP4 ranges/exercise and NAFLD was additionally evaluated in 126 non-obese people recruited in the identical setting.
Outcomes: NAFLD sufferers had considerably larger circulating DPP4 exercise than no-NAFLD in each the overweight and non-obese cohorts; plasma DPP4 exercise and ranges linearly correlated with steatosis grade and irritation on the liver biopsy. Hepatic DPP4 mRNA was not related to both its circulating ranges/exercise or NAFLD. Within the multivariate logistic regression evaluation on all of the examine contributors (n = 178), larger circulating DPP4 exercise was related to NAFLD independently of potential confounders with OR (95% CI): 3.5 (1.2-10.21), p = 0.022.
Conclusions: This examine demonstrates the coexistence of elevated plasma DPP4 ranges and exercise in NAFLD. Circulating DPP4 measurement might signify a novel cost-effective technique for NAFLD/NASH danger stratification and a possible device for monitoring illness’s development in established NAFLD.
The first outcomes have been the reductions in glycated hemoglobin (HbA1c) and glucose oscillation, recognized utilizing steady glucose monitoring, after 12 weeks. The secondary consequence was the change in carotid intima-media thickness (IMT), measured by ultrasonography, after 48 weeks. A complete of 61 sufferers have been recruited and analyzed within the examine. Twelve weeks of therapy with 1.5 mg repaglinide or 1 mg glimepiride considerably decreased HbA1c, and a bigger discount in HbA1c occurred within the repaglinide group than the glimepiride group. Imply subcutaneous glucose focus was considerably decreased in each teams, however the glucose oscillation didn’t lower.

Nitric oxide debilitates the neuropathogenic schistosome Trichobilharzia regenti in mice, partly by inhibiting its important peptidases

Background: Avian schistosomes, the causative brokers of human cercarial dermatitis (or swimmer’s itch), die in mammals however the mechanisms accountable for parasite elimination are unknown. Right here we examined the position of reactive nitrogen species, nitric oxide (NO) and peroxynitrite, within the immune response of mice experimentally contaminated with Trichobilharzia regenti, a mannequin species of avian schistosomes exceptional for its neuropathogenicity.
Strategies: Inducible NO synthase (iNOS) was localized by immunohistochemistry within the pores and skin and the spinal twine of mice contaminated by T. regenti. The affect of iNOS inhibition by aminoguanidine on parasite burden and progress was then evaluated in vivo. The vulnerability of T. regenti schistosomula to NO and peroxynitrite was assessed in vitro by viability assays and electron microscopy. Moreover, the impact of NO on the exercise of T. regenti peptidases was examined utilizing a fluorogenic substrate.
Outcomes: iNOS was detected across the parasites within the dermis eight h post-infection and in addition within the spinal twine Three days post-infection (dpi). Inhibition of iNOS resulted in slower parasite progress Three dpi, however the reverse impact was noticed 7 dpi. On the latter time level, reasonably elevated parasite burden was additionally seen within the spinal twine. In vitro, NO didn’t impair the parasites, however inhibited the exercise of T. regenti cathepsins B1.1 and B2, the peptidases important for parasite migration and digestion. Peroxynitrite severely broken the floor tegument of the parasites and decreased their viability in vitro, however fairly didn’t take part in parasite clearance in vivo.
Conclusions: Reactive nitrogen species, particularly NO, don’t immediately kill T. regenti in mice. NO promotes the parasite progress quickly after penetration (Three dpi), however prevents it later (7 dpi) when additionally suspends the parasite migration within the CNS. NO-related disruption of the parasite proteolytic equipment is partly accountable for this impact.
 Circulating dipeptidyl peptidase-4 is independently associated with the presence and severity of NAFLD/NASH in individuals with and without obesity and metabolic disease

Circulating dipeptidyl peptidase-4 is independently associated with the presence and severity of NAFLD/NASH in individuals with and without obesity and metabolic disease

The Impact of Dipeptidyl Peptidase-Four Inhibitors on Macrovascular and Microvascular Issues of Diabetes Mellitus: A Systematic Overview

Background: The World Well being Group estimates that diabetes is the seventh main reason for loss of life. Uncontrolled diabetes might trigger extreme penalties similar to cardiovascular (CV) occasions (myocardial infarction, stroke, or CV mortality), lower-extremity amputations, and end-stage renal illness. Microvascular issues embrace retinopathy, autonomic and peripheral neuropathy, nephropathy, and diabetic ulcers. Main CV outcomes trials that have been by the Meals and Drug Administration for all new antihyperglycemia drugs for sufferers at excessive danger for CV occasions have been just lately accomplished for all Four US-marketed dipeptidyl peptidase-4 (DPP-4) inhibitors.
Goal: To current a complete assessment of the medical trials that consider macrovascular and microvascular issues reported with DPP-Four inhibitors in sufferers with kind 2 diabetes mellitus.
Strategies: On this assessment, we analyzed printed articles in PubMed and Ovid databases between January 2008 and September 2019 that evaluated the impact of DPP-Four inhibitors on macrovascular and microvascular issues in sufferers with kind 2 diabetes mellitus.
Outcomes: A complete of 18 research, which included randomized managed trials and meta-analyses have been assessed. Present proof demonstrates that the addition of DPP-Four inhibitors to plain antihyperglycemic and CV danger discount therapy has not proven CV profit relative to placebo in distinction to just lately printed research for different drugs throughout the glucagon-like peptide 1 agonist and sodium-glucose co-transporter 2 inhibitor courses. Notably, the potential danger for coronary heart failure hospitalizations might exist for saxagliptin, and this impact is just not extrapolated as a category impact.

SERPINA10 antibody

70R-20166 50 ul
EUR 435
Description: Rabbit polyclonal SERPINA10 antibody

SERPINA10 Antibody

1-CSB-PA891944ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SERPINA10. Recognizes SERPINA10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SERPINA10 Antibody

1-CSB-PA891944ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SERPINA10. Recognizes SERPINA10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SERPINA10 Antibody

DF9787 200ul
EUR 304
Description: SERPINA10 Antibody detects endogenous levels of total SERPINA10.

SERPINA10 antibody

70R-9712 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SERPINA10 antibody

SERPINA10 Antibody

1-CSB-PA021054GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SERPINA10. Recognizes SERPINA10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SERPINA10 siRNA

20-abx904873
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SERPINA10 siRNA

20-abx932949
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SERPINA10 siRNA

20-abx932950
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SERPINA10 Antibody

ABD9787 100 ug
EUR 438

anti-SERPINA10

YF-PA18888 50 ug
EUR 363
Description: Mouse polyclonal to SERPINA10

anti-SERPINA10

YF-PA18889 100 ug
EUR 403
Description: Rabbit polyclonal to SERPINA10

anti-SERPINA10

YF-PA26143 50 ul
EUR 334
Description: Mouse polyclonal to SERPINA10

HEK-293T Telomerase Over-Expressing Cell Pellet

abx069991-1Pellet 1 Pellet
EUR 398
  • Shipped within 1-3 working days.

SERPINA10 Polyclonal Antibody

30600-100ul 100ul
EUR 252

SERPINA10 Polyclonal Antibody

30600-50ul 50ul
EUR 187

SERPINA10 Polyclonal Antibody

30825-100ul 100ul
EUR 252

SERPINA10 Polyclonal Antibody

30825-50ul 50ul
EUR 187

SERPINA10 cloning plasmid

CSB-CL891944HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1335
  • Sequence: atgaaggtggtgccaagtctcctgctctccgtcctcctggcacaggtgtggctggtacccggcttggcccccagtcctcagtcgccagagaccccagcccctcagaaccagaccagcagggtagtgcaggctcccaaggaggaagaggaagatgagcaggaggccagcgaggaga
  • Show more
Description: A cloning plasmid for the SERPINA10 gene.

SERPINA10 Blocking Peptide

DF9787-BP 1mg
EUR 195

SERPINA10 Rabbit pAb

A7106-100ul 100 ul
EUR 308

SERPINA10 Rabbit pAb

A7106-200ul 200 ul
EUR 459

SERPINA10 Rabbit pAb

A7106-20ul 20 ul
EUR 183

SERPINA10 Rabbit pAb

A7106-50ul 50 ul
EUR 223

SERPINA10 Rabbit pAb

A4717-100ul 100 ul
EUR 308

SERPINA10 Rabbit pAb

A4717-200ul 200 ul
EUR 459

SERPINA10 Rabbit pAb

A4717-20ul 20 ul
EUR 183

SERPINA10 Rabbit pAb

A4717-50ul 50 ul
EUR 223

anti- SERPINA10 antibody

FNab07739 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
  • Uniprot ID: Q9UK55
  • Gene ID: 51156
  • Research Area: Metabolism
Description: Antibody raised against SERPINA10

anti- SERPINA10 antibody

FNab07740 100µg
EUR 585
  • Recommended dilution: WB: 1:1500-1:6000
  • IF: 1:50-1:500
  • IHC: 1:50-1:500
  • Immunogen: serpin peptidase inhibitor, clade A(alpha-1 antiproteinase, antitrypsin), member 10
  • Uniprot ID: Q9UK55
  • Gene ID: 51156
  • Research Area: Metabolism
Description: Antibody raised against SERPINA10

Anti-SERPINA10 antibody

PAab07739 100 ug
EUR 386

Anti-SERPINA10 antibody

STJ116256 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the serpin family. It is predominantly expressed in the liver and secreted in plasma. It inhibits the activity of coagulation factors Xa and XIa in the presence of protein Z, calcium and phospholipid. Mutations in this gene are associated with venous thrombosis. Alternatively spliced transcript variants have been found for this gene.

Anti-SERPINA10 antibody

STJ29186 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the serpin family. It is predominantly expressed in the liver and secreted in plasma. It inhibits the activity of coagulation factors Xa and XIa in the presence of protein Z, calcium and phospholipid. Mutations in this gene are associated with venous thrombosis. Alternatively spliced transcript variants have been found for this gene.

Anti-SERPINA10 (1E11)

YF-MA18425 100 ug
EUR 363
Description: Mouse monoclonal to SERPINA10

Chymase reagent

30C-CP1129 5 units
EUR 2185
Description: Purified native Human Chymase reagent

Traut's Reagent

2330-1000
EUR 349

Traut's Reagent

2330-500
EUR 207

MTS Reagent

2808-1000
EUR 990

MTS Reagent

2808-250
EUR 365

MTT Reagent

2809-1G
EUR 180

MTT Reagent

2809-5G
EUR 544

BOP reagent

5-02141 25g Ask for price

BOP reagent

5-02142 100g Ask for price

Bluing Reagent

BRT030 30 ml
EUR 60

Bluing Reagent

BRT125 125 ml
EUR 63

Bluing Reagent

BRT3800 1 Gal.
EUR 184

Bluing Reagent

BRT500 500 ml
EUR 76

Bluing Reagent

BRT999 1000 ml
EUR 88

BOP reagent

A7015-100000 100 g
EUR 200
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

A7015-25000 25 g
EUR 113
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

Beaucage reagent

HY-100951 10mM/1mL
EUR 126

Bradford reagent

BDE641 100ml
EUR 61.01
  • Product category: Biochemicals/Biology Reagents/Protein Related

Human SERPINA10 ELISA KIT

ELI-28621h 96 Tests
EUR 824

SERPINA10 ELISA KIT|Human

EF002828 96 Tests
EUR 689

Rat SERPINA10 shRNA Plasmid

20-abx987719
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SERPINA10 Polyclonal Conjugated Antibody

C30600 100ul
EUR 397

SERPINA10 Polyclonal Conjugated Antibody

C30825 100ul
EUR 397

Human SERPINA10 shRNA Plasmid

20-abx959569
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SERPINA10 shRNA Plasmid

20-abx981163
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Serpina10 ELISA KIT

ELI-40459m 96 Tests
EUR 865

Anti-SERPINA10 / ZPI antibody

STJ71606 100 µg
EUR 359

Arabidopsis Thaliana Lysate

30R-AA023 150 ug
EUR 156
Description: Arabidopsis Thaliana Plant Lysate

CMV Cell Lysate

35-1867 1 mg
EUR 1835
Description: CMV enriched cell lysate

HSV1 Cell Lysate

35-1872 1 ml
EUR 394
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate

35-1873 1 ml
EUR 394
Description: HSV2 enriched cell lysate

JM109-lysate Antibody

abx234439-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21-lysate Antibody

abx230905-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

DH5a-lysate Antibody

abx232362-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Green Algae Lysate

PABL-1306 50 ug
EUR 164

BSA (Reagent Grade)

30-AB79 1 kg
EUR 1552
Description: Reagent Grade Bovine Serum Albumin (99% pure)

BSA (Reagent Grade)

30-AB81 200 grams
EUR 476
Description: Reagent Grade Sulphydryl Blocked BSA (99% pure)

Griess Reagent Kit

30100 1KIT
EUR 149
Description: Minimum order quantity: 1 unit of 1KIT

BODIPY-Acetylene Reagent

2594-1
EUR 207

BODIPY-Acetylene Reagent

2594-5
EUR 675

Biotin reagent (HRP)

65C-CE0202 5 mg
EUR 244
Description: HRP conjugated biotin labelling reagent

Convoy? Transfection Reagent

1110-1ml
EUR 341

Bradford Dye Reagent

0209R 100 ml
EUR 131

HAMA blocking reagent

85R-1001 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1001P 1 gram
EUR 2190
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1003 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as Rapid Tests

HAMA blocking reagent

85R-1014 50 mg
EUR 192
Description: HAMA blocking reagent for use in assays specific for clinical false positive samples

HAMA blocking reagent

85R-1025 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

HAMA blocking reagent

85R-1026 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

Girard's reagent T

20-abx184099
  • EUR 203.00
  • EUR 314.00
  • 100 g
  • 500 g
  • Shipped within 1-2 weeks.

EL Transfection Reagent

20-abx098880
  • EUR 384.00
  • EUR 537.00
  • 0.75 ml
  • 1.5 ml
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx098886
  • EUR 425.00
  • EUR 509.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

Alcohol, Reagent (70%)

EAS500 500 ml
EUR 79

Alcohol, Reagent (70%)

EAS999 1000 ml
EUR 101

BCA Reagent, 16ML

C144-16ML 16ML
EUR 163

Biolipidure-1002-Reagent

Biolipidure-1002-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1002-Reagent

Biolipidure-1002-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

FcR blocking Reagent

20-abx290024
  • EUR 377.00
  • EUR 516.00
  • 200 tests
  • 400 tests
  • Shipped within 2-3 weeks.

Detection Reagent A

abx296004-120ul 120 ul
EUR 321
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx298005
  • EUR 203.00
  • EUR 286.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

PhosphoBlocker Blocking Reagent

AKR-103 1L
EUR 328
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

PhosphoBlocker Blocking Reagent

AKR-104 4L
EUR 711
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

Tri-RNA Reagent

FATRR-001 100ml
EUR 236

Tri-RNA Reagent

FATRR-002 50ml
EUR 176

Tri-RNA Reagent

FATRR-003 450ml
EUR 645

LP4K Transfection Reagent

LP4K 1.0 ml / vial
EUR 304
Description: Lipid based transfection reagent for large plasmid and multiple plasmid transfection in both adhesive and suspenstion cell types.

PureFection Transfection Reagent

LV750A-1 1 ml
EUR 359
  • Category: Lentiviral Technology

HighGene transfection reagent

RM09014 1000μl
EUR 270

TissueDigest Reagent, 20X

T101 10ml
EUR 210

ExFect2000 Transfection Reagent

T202-01 0.5 ml
EUR 227

ExFect2000 Transfection Reagent

T202-02 1 ml
EUR 316

ExFect2000 Transfection Reagent

T202-03 5 ml
EUR 1052

Dissociation Reagent, 1ML

X017-1ML 1ML
EUR 109

Dissociation Reagent, 25ML

X017-25ML 25ML
EUR 258

Dissociation Reagent, 5ML

X017-5ML 5ML
EUR 122

Dissociation Reagent, 1ML

X058-1ML 1ML
EUR 73

Dissociation Reagent, 5ML

X058-5ML 5ML
EUR 109

DTT (Cleland's reagent)

DB0058 5g
EUR 84.8
  • Product category: Electrophoresis Related/Reducing Agents

DTNB (Ellman's Reagent)

DB0113 5g
EUR 97.85
  • Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

Ethyl acetate Reagent

EC4600 1L
EUR 79
  • Product category: Biochemicals/Solvents

n-Heptane Reagent

HC5400 1L
EUR 79
  • Product category: Biochemicals/Solvents

Polyclonal SERPINA10 antibody - middle region

APR01400G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SERPINA10 - middle region. This antibody is tested and proven to work in the following applications:

Serpina10 ORF Vector (Rat) (pORF)

ORF076060 1.0 ug DNA
EUR 506

SERPINA10 ORF Vector (Human) (pORF)

ORF009375 1.0 ug DNA
EUR 95

Serpina10 ORF Vector (Mouse) (pORF)

ORF056993 1.0 ug DNA
EUR 506

SERPINA10 ELISA Kit (Human) (OKCD01620)

OKCD01620 96 Wells
EUR 831
Description: Description of target: Inhibits activity of the coagulation protease factor Xa in the presence of PROZ, calcium and phospholipids. Also inhibits factor XIa in the absence of cofactors.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.49 ng/mL

Human Brain Tissue Lysate

30R-AB017 150 ug
EUR 273
Description: Fresh tissue lysate isolated from human brain

Chicken Liver Tissue Lysate

30R-AC011 150 ug
EUR 192
Description: Freshly prepared tissue lysate isolated from liver of normal chicken

Human Cerebellum Tissue Lysate

30R-AC058 150 ug
EUR 290
Description: Freshly prepared tissue lysate isolated from cerebellum of human brain

Human Hippocampus Tissue Lysate

30R-AH 150 ug
EUR 273
Description: Isolated Human Hippocampus Tissue Lysate

Human Heart Tissue Lysate

30R-AH049 150 ug
EUR 534
Description: Fresh tissue lysate isolated from human heart

Jurkat cell Lysate (untreated)

2401-100
EUR 185
Primarily based on our assessment, DPP-Four inhibitors might not affect microvascular issues in sufferers with diabetes. Nonetheless, some research have proven that saxagliptin and linagliptin might decelerate the development of albuminuria in sufferers with kind 2 diabetes mellitus. The general high quality of the research included on this assessment was excessive as a result of inclusion of randomized managed trials and meta-analyses.