Dipeptidyl peptidase 4 inhibitors in the treatment of type 2 diabetes mellitus

Dipeptidyl peptidase 4 inhibitors in the treatment of type 2 diabetes mellitus

December 22, 2020 0 By Keith

Dipeptidyl peptidase Four inhibitors (DPP4i) have been out there for treating kind 2 diabetes mellitus since 2006. Though they’re a various group, DPP4i are all small, orally out there molecules that work together with the catalytic website of DPP4 with out disturbing any of its different identified features, together with its results on the immune system. DPP4i don’t have any intrinsic glucose-lowering exercise, so their efficacy as anti-diabetic brokers is said on to their capability to inhibit DPP4 exercise and is mediated by way of the consequences of the substrates they defend. Of those, the incretin hormone, glucagon-like peptide 1, might be crucial. As the consequences of glucagon-like peptide 1 are glucose-dependent, the chance of hypoglycaemia with DPP4i is low.

Class results, that are instantly associated to the mechanism of motion, are frequent to all DPP4i; these embrace their total good security profile and tolerability, in addition to their efficacy in enhancing glycaemic management, but additionally, doubtlessly, a small elevated danger of acute pancreatitis. Compound-specific results are these associated to their differing chemistries and/or pharmacokinetic profiles. These compound-specific results may have an effect on the best way through which particular person DPP4i are used therapeutically and doubtlessly clarify off-target antagonistic results, comparable to hospitalization for coronary heart failure, which is seen solely with one DPP4i. General, DPP4i have a beneficial therapeutic profile and are protected and efficient within the majority of sufferers with kind 2 diabetes mellitus.  Households through which the proteins share related tertiary buildings are assembled right into a clan.

The MEROPS classification is thus a hierarchy with at the very least three ranges (protein-species, household and clan) displaying the evolutionary relationship. A number of different knowledge collections have been assembled that are accessed from all ranges within the hierarchy. These embrace, sequence homologues, selective bibliographies, substrate cleavage websites, peptidase-inhibitor interactions, alignments and phylogenetic bushes. The substrate cleavage assortment has been assembled from the literature and consists of physiological, pathological and non-physiological cleavages in proteins, peptides and artificial substrates.

 

Unstable Mechanisms of Resistance to Inhibitors of Escherichia coli Lipoprotein Sign Peptidase

Medical growth of antibiotics with novel mechanisms of motion to kill pathogenic micro organism is difficult, partially, as a result of inevitable emergence of resistance. A phenomenon of potential scientific significance that’s broadly missed in preclinical growth is heteroresistance, an often-unstable phenotype through which subpopulations of bacterial cells present decreased antibiotic susceptibility relative to the dominant inhabitants. Right here, we describe a brand new globomycin analog, G0790, with potent exercise in opposition to the Escherichia coli kind II sign peptidase LspA and uncover two novel resistance mechanisms to G0790 within the scientific uropathogenic E. coli pressure CFT073.
Constructing on the earlier discovering that full deletion of Lpp, the foremost Gram-negative outer membrane lipoprotein, results in globomycin resistance, we additionally discover that an unexpectedly modest lower in Lpp ranges mediated by insertion-based disruption of regulatory parts is ample to confer G0790 resistance and enhance sensitivity to serum killing. As well as, we describe a heteroresistance phenotype mediated by genomic amplifications of lspA that lead to elevated LspA ranges ample to beat inhibition by G0790 in tradition.
These genomic amplifications are extremely unstable and are misplaced after as few as two subcultures within the absence of G0790, which locations amplification-containing resistant strains at excessive danger of being misclassified as prone by routine antimicrobial susceptibility testing. In abstract, our examine uncovers two vastly totally different mechanisms of resistance to LspA inhibitors in E. coli and emphasizes the significance of contemplating the potential impression of unstable and heterogenous phenotypes when creating antibiotics for scientific use.
IMPORTANCE Regardless of growing proof suggesting that antibiotic heteroresistance can result in remedy failure, the importance of this phenomena within the clinic is just not properly understood, as a result of many scientific antibiotic susceptibility testing approaches lack the decision wanted to reliably classify heteroresistant strains. Right here we current G0790, a brand new globomycin analog and potent inhibitor of the Escherichia coli kind II sign peptidase LspA. We reveal that along with beforehand identified mechanisms of resistance to LspA inhibitors, unstable genomic amplifications containing lspA can result in modest but biologically important will increase in LspA protein ranges that confer a heteroresistance phenotype.
 Dipeptidyl peptidase 4 inhibitors in the treatment of type 2 diabetes mellitus

Dipeptidyl peptidase 4 inhibitors in the treatment of type 2 diabetes mellitus

Molecular cloning and characterization of a novel peptidase from Trichinella spiralis and protecting immunity elicited by the peptidase in BALB/c mice

In our earlier research, a novel T. spiralis peptidase (TsP) was recognized among the many excretory/secretory (ES) proteins of T. spiralis intestinal infective larvae (IIL) and T. spiralis on the grownup worm (AW) stage utilizing immunoproteomics, however the organic perform of TsP within the life cycle of T. spiralis is just not clear. The target of this examine was to research the organic properties and features of TsP in larval intrusion and protecting immunity induced by immunization with rTsP. The whole TsP cDNA sequence was cloned and expressed.
The outcomes of RT-PCR, oblique immunofluorescence assay (IIFA) and western blotting revealed that TsP is a floor and secretory protein expressed in T. spiralis at totally different levels (muscle larvae, IIL, AWs and new child larvae) that’s principally localized on the epicuticle of the nematode. rTsP facilitated the larval intrusion of intestinal epithelial cells (IECs) and intestinal mucosa, whereas anti-rTsP antibodies suppressed larval intrusion; these facilitative and suppressive roles had been dose-dependently associated to rTsP or anti-rTsP antibodies.

SERPINH1 Antibody

32687-100ul 100ul
EUR 252

SERPINH1 Antibody

43691-100ul 100ul
EUR 252

SERPINH1 Antibody

DF6980 200ul
EUR 304
Description: SERPINH1 Antibody detects endogenous levels of total SERPINH1.

SERPINH1 Antibody

1-CSB-PA021087ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SERPINH1. Recognizes SERPINH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:50-1:200

SERPINH1 Antibody

1-CSB-PA021087GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SERPINH1. Recognizes SERPINH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Serpinh1 Antibody

1-CSB-PA021087LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Serpinh1. Recognizes Serpinh1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

SERPINH1 Antibody

ABD6980 100 ug
EUR 438

SERPINH1 Conjugated Antibody

C43691 100ul
EUR 397

SERPINH1 Conjugated Antibody

C32687 100ul
EUR 397

Serpinh1 Polyclonal Antibody

A60854 100 µg
EUR 570.55
Description: kits suitable for this type of research

Anti-SERPINH1 antibody

STJ11100256 100 µl
EUR 393
Description: This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The encoded protein is localized to the endoplasmic reticulum and plays a role in collagen biosynthesis as a collagen-specific molecular chaperone. Autoantibodies to the encoded protein have been found in patients with rheumatoid arthritis. Expression of this gene may be a marker for cancer, and nucleotide polymorphisms in this gene may be associated with preterm birth caused by preterm premature rupture of membranes. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9.

Anti-SERPINH1 antibody

STJ115435 100 µl
EUR 277
Description: This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The encoded protein is localized to the endoplasmic reticulum and plays a role in collagen biosynthesis as a collagen-specific molecular chaperone. Autoantibodies to the encoded protein have been found in patients with rheumatoid arthritis. Expression of this gene may be a marker for cancer, and nucleotide polymorphisms in this gene may be associated with preterm birth caused by preterm premature rupture of membranes. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9.

Rat SERPINH1 shRNA Plasmid

20-abx985437
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SERPINH1 siRNA

20-abx904881
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SERPINH1 siRNA

20-abx933022
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SERPINH1 siRNA

20-abx933023
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Serpin H1 (SERPINH1) Antibody

20-abx115477
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serpin H1 (SERPINH1) Antibody

abx033355-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serpin H1 (SERPINH1) Antibody

abx033355-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serpin H1 (SERPINH1) Antibody

abx033356-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serpin H1 (SERPINH1) Antibody

abx033356-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Polyclonal SERPINH1 Antibody (Center)

APR05898G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SERPINH1 (Center). This antibody is tested and proven to work in the following applications:

Serpinh1 Antibody, HRP conjugated

1-CSB-PA021087LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Serpinh1. Recognizes Serpinh1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Serpinh1 Antibody, FITC conjugated

1-CSB-PA021087LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Serpinh1. Recognizes Serpinh1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Serpinh1 Antibody, Biotin conjugated

1-CSB-PA021087LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Serpinh1. Recognizes Serpinh1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Serpin H1 (Serpinh1) Antibody

20-abx319337
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serpin H1 (SERPINH1) Antibody

20-abx321407
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serpin H1 (SERPINH1) Antibody

20-abx001958
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-Hsp47/SERPINH1 Antibody

PB9325 100ug/vial
EUR 334

Serpinh1 ORF Vector (Rat) (pORF)

ORF076093 1.0 ug DNA
EUR 506

SERPINH1 ELISA Kit (Rat) (OKCA02556)

OKCA02556 96 Wells
EUR 930
Description: Description of target: Binds specifically to collagen. Could be involved as a chaperone in the biosynthetic pathway of collagen. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.039 ng/mL

SERPINH1 ELISA Kit (Rat) (OKEH06315)

OKEH06315 96 Wells
EUR 662
Description: Description of target: Binds specifically to collagen. Could be involved as a chaperone in the biosynthetic pathway of collagen. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78 ng/mL

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

SERPINH1 Rabbit pAb

A13474-100ul 100 ul
EUR 308

SERPINH1 Rabbit pAb

A13474-200ul 200 ul
EUR 459

SERPINH1 Rabbit pAb

A13474-20ul 20 ul
EUR 183

SERPINH1 Rabbit pAb

A13474-50ul 50 ul
EUR 223

SERPINH1 Blocking Peptide

33R-2012 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SERPINH1 antibody, catalog no. 20R-1310

SERPINH1 Blocking Peptide

DF6980-BP 1mg
EUR 195

SERPINH1 cloning plasmid

CSB-CL021087HU-10ug 10ug
EUR 461
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1257
  • Sequence: atgcgctccctcctgcttctcagcgccttctgcctcctggaggcggccctggccgccgaggtgaagaaacctgcagccgcagcagctcctggcactgcggagaagttgagccccaaggcggccacgcttgccgagcgcagcgccggcctggccttcagcttgtaccaggccatgg
  • Show more
Description: A cloning plasmid for the SERPINH1 gene.

SERPINH1 Rabbit pAb

A18300-100ul 100 ul
EUR 384

SERPINH1 Rabbit pAb

A18300-200ul 200 ul
EUR 554

SERPINH1 Rabbit pAb

A18300-20ul 20 ul Ask for price

SERPINH1 Rabbit pAb

A18300-50ul 50 ul Ask for price

Polyclonal SERPINH1 Antibody (C-term)

APR05897G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SERPINH1 (C-term). This antibody is tested and proven to work in the following applications:

Serpin H1 (Serpinh1) Antibody (HRP)

20-abx319096
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serpin H1 (Serpinh1) Antibody (FITC)

20-abx319097
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serpin H1 (Serpinh1) Antibody (Biotin)

20-abx319098
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serpinh1 Polyclonal Antibody, Biotin Conjugated

A60855 100 µg
EUR 570.55
Description: fast delivery possible

Serpinh1 Polyclonal Antibody, FITC Conjugated

A60856 100 µg
EUR 570.55
Description: reagents widely cited

Serpinh1 Polyclonal Antibody, HRP Conjugated

A60857 100 µg
EUR 570.55
Description: Ask the seller for details

Rat Serpin H1(SERPINH1) ELISA kit

E02S0361-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Serpin H1(SERPINH1) ELISA kit

E02S0361-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Serpin H1(SERPINH1) ELISA kit

E02S0361-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Serpinh1 sgRNA CRISPR Lentivector set (Rat)

K6768901 3 x 1.0 ug
EUR 339

Polyclonal SERPINH1 antibody - C-terminal region

APR01904G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SERPINH1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Mouse Serpin H1 (Serpinh1)

1-CSB-EP021087MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 60.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serpin H1(Serpinh1) expressed in E.coli

Mouse Serpin H1 (Serpinh1)

1-CSB-YP021087MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 46.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serpin H1(Serpinh1) expressed in Yeast

Human SERPINH1 ELISA Kit

ELA-E0266h 96 Tests
EUR 824

Heat Shock 47kDa/SERPINH1

E21-800 10ug
EUR 343

SERPINH1 ELISA KIT|Human

EF007167 96 Tests
EUR 689

Mouse SERPINH1 shRNA Plasmid

20-abx969508
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SERPINH1 shRNA Plasmid

20-abx950615
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Serpinh1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6768902 1.0 ug DNA
EUR 154

Serpinh1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6768903 1.0 ug DNA
EUR 154

Serpinh1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6768904 1.0 ug DNA
EUR 154

SERPINH1 Protein Vector (Rat) (pPB-C-His)

PV304370 500 ng
EUR 603

SERPINH1 Protein Vector (Rat) (pPB-N-His)

PV304371 500 ng
EUR 603

SERPINH1 Protein Vector (Rat) (pPM-C-HA)

PV304372 500 ng
EUR 603

SERPINH1 Protein Vector (Rat) (pPM-C-His)

PV304373 500 ng
EUR 603

Rat Heat Shock Protein 47 (SERPINH1) ELISA Kit

abx255727-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

SERPINH1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV659533 1.0 ug DNA
EUR 682

SERPINH1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV659537 1.0 ug DNA
EUR 682

SERPINH1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV659538 1.0 ug DNA
EUR 682

SERPINH1 ORF Vector (Human) (pORF)

ORF009400 1.0 ug DNA
EUR 95

Serpinh1 ORF Vector (Mouse) (pORF)

ORF057064 1.0 ug DNA
EUR 506

Serpinh1 ORF Vector (Mouse) (pORF)

ORF057065 1.0 ug DNA
EUR 506

Serpinh1 ORF Vector (Mouse) (pORF)

ORF057066 1.0 ug DNA
EUR 506

SERPINH1 ELISA Kit (Human) (OKAN06611)

OKAN06611 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The encoded protein is localized to the endoplasmic reticulum and plays a role in collagen biosynthesis as a collagen-specific molecular chaperone. Autoantibodies to the encoded protein have been found in patients with rheumatoid arthritis. Expression of this gene may be a marker for cancer, and nucleotide polymorphisms in this gene may be associated with preterm birth caused by preterm premature rupture of membranes. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 50 pg/mL

SERPINH1 ELISA Kit (Human) (OKCD06194)

OKCD06194 96 Wells
EUR 753
Description: Description of target: Serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 46pg/mL

SERPINH1 ELISA Kit (Mouse) (OKEH03077)

OKEH03077 96 Wells
EUR 740
Description: Description of target: Binds specifically to collagen. Could be involved as a chaperone in the biosynthetic pathway of collagen.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.1 pg/mL

SERPINH1 ELISA Kit (Human) (OKEH04176)

OKEH04176 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The encoded protein is localized to the endoplasmic reticulum and plays a role in collagen biosynthesis as a collagen-specific molecular chaperone. Autoantibodies to the encoded protein have been found in patients with rheumatoid arthritis. Expression of this gene may be a marker for cancer, and nucleotide polymorphisms in this gene may be associated with preterm birth caused by preterm premature rupture of membranes. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 100 pg/mL

Rabbit Serpin H1(SERPINH1) ELISA kit

E04S0361-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Serpin H1(SERPINH1) ELISA kit

E04S0361-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Serpin H1(SERPINH1) ELISA kit

E04S0361-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Serpin H1(SERPINH1) ELISA kit

E03S0361-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Serpin H1(SERPINH1) ELISA kit

E03S0361-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Serpin H1(SERPINH1) ELISA kit

E03S0361-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Serpin H1(SERPINH1) ELISA kit

E01S0361-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Serpin H1(SERPINH1) ELISA kit

E01S0361-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Serpin H1(SERPINH1) ELISA kit

E01S0361-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Serpin H1(SERPINH1) ELISA kit

E06S0361-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Serpin H1(SERPINH1) ELISA kit

E06S0361-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Serpin H1(SERPINH1) ELISA kit

E06S0361-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Serpin H1(SERPINH1) ELISA kit

E08S0361-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Serpin H1(SERPINH1) ELISA kit

E08S0361-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Serpin H1(SERPINH1) ELISA kit

E08S0361-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Serpin H1(SERPINH1) ELISA kit

E07S0361-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Serpin H1(SERPINH1) ELISA kit

E07S0361-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Serpin H1(SERPINH1) ELISA kit

E07S0361-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Serpin H1(SERPINH1) ELISA kit

E09S0361-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Serpin H1(SERPINH1) ELISA kit

E09S0361-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Serpin H1(SERPINH1) ELISA kit

E09S0361-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Serpinh1/ Serpin H1 ELISA Kit

E1335Mo 1 Kit
EUR 571

Human SERPINH1/ Serpin H1 ELISA Kit

E2266Hu 1 Kit
EUR 571

Human SERPINH1(Serpin H1) ELISA Kit

EH0812 96T
EUR 567.6
  • Detection range: 0.125-8 ng/ml
  • Uniprot ID: P50454
  • Alias: SERPINH1(Serpin H1)/PIG14/CBP1/CBP2/HSP47/SERPINH2/Rheumatoid arthritis-related antigen RA-A47/Collagen-binding protein(Colligin)/Cell proliferation-inducing gene 14 protein/47 kDa heat shock p
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.075 ng/ml

Serpinh1 sgRNA CRISPR Lentivector set (Mouse)

K4997301 3 x 1.0 ug
EUR 339

SERPINH1 sgRNA CRISPR Lentivector set (Human)

K2126401 3 x 1.0 ug
EUR 339

Serpinh1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6768905 3 x 1.0 ug
EUR 376

Guinea pig Serpin H1(SERPINH1) ELISA kit

E05S0361-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Serpin H1(SERPINH1) ELISA kit

E05S0361-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Serpin H1(SERPINH1) ELISA kit

E05S0361-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Serpin H1(SERPINH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Serpinh1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4997302 1.0 ug DNA
EUR 154

Serpinh1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4997303 1.0 ug DNA
EUR 154

Serpinh1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4997304 1.0 ug DNA
EUR 154

SERPINH1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2126402 1.0 ug DNA
EUR 154

SERPINH1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2126403 1.0 ug DNA
EUR 154

SERPINH1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2126404 1.0 ug DNA
EUR 154

ELISA kit for Human Serpin H1 (SERPINH1)

KTE60689-48T 48T
EUR 332
  • Heat shock protein 47 is a member of the serpin superfamily of serine proteinase inhibitors. Its expression is induced by heat shock. The protein localizes to the endoplasmic reticulum lumen and binds collagen
  • thus it is thought to be a molecular ch
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serpin H1 (SERPINH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serpin H1 (SERPINH1)

KTE60689-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Heat shock protein 47 is a member of the serpin superfamily of serine proteinase inhibitors. Its expression is induced by heat shock. The protein localizes to the endoplasmic reticulum lumen and binds collagen
  • thus it is thought to be a molecular ch
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serpin H1 (SERPINH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serpin H1 (SERPINH1)

KTE60689-96T 96T
EUR 539
  • Heat shock protein 47 is a member of the serpin superfamily of serine proteinase inhibitors. Its expression is induced by heat shock. The protein localizes to the endoplasmic reticulum lumen and binds collagen
  • thus it is thought to be a molecular ch
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serpin H1 (SERPINH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SERPINH1 Heat Shock 47kDa Human Recombinant Protein

PROTP50454 Regular: 50ug
EUR 317
Description: Recombinant Human HSP47 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 422 amino acids (18-418 a.a) and having a molecular mass of 46.8kDa. ;HSP47 human recombinant is fused to a 20 amino acid His Tag at N-terminus and purified by convential chromatogrpahy techniques.

SERPINH1 Protein Vector (Human) (pPB-C-His)

PV037597 500 ng
EUR 329

SERPINH1 Protein Vector (Human) (pPB-N-His)

PV037598 500 ng
EUR 329

SERPINH1 Protein Vector (Human) (pPM-C-HA)

PV037599 500 ng
EUR 329

SERPINH1 Protein Vector (Human) (pPM-C-His)

PV037600 500 ng
EUR 329

SERPINH1 Protein Vector (Mouse) (pPB-C-His)

PV228254 500 ng
EUR 603

SERPINH1 Protein Vector (Mouse) (pPB-N-His)

PV228255 500 ng
EUR 603

SERPINH1 Protein Vector (Mouse) (pPM-C-HA)

PV228256 500 ng
EUR 603

SERPINH1 Protein Vector (Mouse) (pPM-C-His)

PV228257 500 ng
EUR 603

SERPINH1 Protein Vector (Mouse) (pPB-C-His)

PV228258 500 ng
EUR 603

SERPINH1 Protein Vector (Mouse) (pPB-N-His)

PV228259 500 ng
EUR 603

SERPINH1 Protein Vector (Mouse) (pPM-C-HA)

PV228260 500 ng
EUR 603

SERPINH1 Protein Vector (Mouse) (pPM-C-His)

PV228261 500 ng
EUR 603

SERPINH1 Protein Vector (Mouse) (pPB-C-His)

PV228262 500 ng
EUR 603

SERPINH1 Protein Vector (Mouse) (pPB-N-His)

PV228263 500 ng
EUR 603

SERPINH1 Protein Vector (Mouse) (pPM-C-HA)

PV228264 500 ng
EUR 603

SERPINH1 Protein Vector (Mouse) (pPM-C-His)

PV228265 500 ng
EUR 603

Recombinant Human SERPINH1 Protein, His, E.coli-10ug

QP13469-10ug 10ug
EUR 155

Recombinant Human SERPINH1 Protein, His, E.coli-1mg

QP13469-1mg 1mg
EUR 1859

Recombinant Human SERPINH1 Protein, His, E.coli-50ug

QP13469-50ug 50ug
EUR 201

Recombinant Human Heat Shock 47kDa/SERPINH1 Protein

RP00556 10 μg
EUR 221

Serpinh1 3'UTR Luciferase Stable Cell Line

TU118647 1.0 ml Ask for price
Immunization of mice with rTsP triggered an apparent humoral immune response (excessive ranges of IgG, IgG1/IgG2a, and sIgA) and likewise elicited systemic (spleen) and intestinal native mucosal (mesenteric lymph node) mobile immune responses, as demonstrated by an evident enhance within the cytokines IFN-γ and IL-4. Immunization of mice with rTsP diminished the numbers of intestinal grownup worms by 38.6% and muscle larvae by 41.93%. These outcomes reveal that TsP performs an important function within the intrusion, growth and survival of T. spiralis in hosts and is a promising candidate goal molecule for anti-Trichinella vaccines.