Best ELISA kit for Human Neuroserpin

Best ELISA kit for Human Neuroserpin

July 24, 2020 0 By Keith

Growth of Pretreatment Protocols for Willpower of Soybean β-Conglycinin in Processed Soybean Meals Utilizing Industrial ELISA Kits

 

  • β-Conglycinin is the most important storage protein in soybeans. Pre-clinical animal fashions and human medical research have demonstrated the triglyceride-lowering impact of this protein, suggesting that it might be put into sensible use as a purposeful meals materials. Up to now, nonetheless, there aren’t any correct and easy assays for quantification of β-conglycinin.

 

  • On this research, samples had been pretreated by mixing them with rice flour powder previous to extraction of proteins. Then, we used commercially out there ELISA kits for detection of allergens that might be current in any contaminating soybean residue. This enabled correct and extremely reproducible quantitation of β-conglycinin content material in a number of processed soybean meals.

        Recombinant Human SerpinI1/ Neuroserpin Protein, Untagged, E.coli-100ug

  • Key phrases: ELISA; Kori-tofu; assay; soybean; soymilk; β-conglycinin.
  • Avian mycoplasmas had been primarily the trigger of poultry trade financial losses; lowered meat and egg manufacturing and will increase the antibiotic remedy value.

 

  • Mycoplasma gallisepticum (MG) an infection is designated as infectious sinusitis of turkeys and persistent respiratory illness of chickens (gasping, despair, semi closed eyes, infraorbital sinuses edema and reduce in egg manufacturing). This research aimed to arrange, consider and Evaluate in-house ELISA kits and lateral circulate assay (LFA) from a neighborhood pressure of MG with business ELISA kits and PCR consequently.

         Recombinant Human SerpinI1/ Neuroserpin Protein, Untagged, E.coli-5ug | Neuroserpin (SERPINI1) Antibody                (HRP)

  • A complete of 54 samples (27 tracheal swabs, 10 trachea and 17 lung) and 50 serum samples collected from birds affected by persistent respiratory illness had been examined by prepared in-house ELISA, business ELISA kits, PCR and LFA; a excessive correlation coefficient between in-house ELISA utilizing complete antigen or sonicated antigen and business equipment was recorded. Lateral Circulate assay (LFA) efficiency point out a low sensitivity (77.5%) however preserve a excessive specificity (92%) compared to PCR.

 

  • The in-house ELISA kits and LFA put togetherd might be used as a quick diagnostic method for detection of MG in Egypt. Based on the out there data the ready LFA for prognosis of MG an infection in chickens was developed for the primary time in Egypt.

SERPIND1 Antibody

CSB-PA788694-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SERPIND1. Recognizes SERPIND1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

SERPIND1 Antibody

CSB-PA788694-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SERPIND1. Recognizes SERPIND1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

SERPIND1 antibody

70R-5267 50 ug
EUR 467
Description: Rabbit polyclonal SERPIND1 antibody

SERPIND1 Antibody

1-CSB-PA009123
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SERPIND1. Recognizes SERPIND1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

SERPIND1 Antibody

1-CSB-PA021080ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SERPIND1. Recognizes SERPIND1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SERPIND1 siRNA

20-abx904878
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SERPIND1 siRNA

20-abx933009
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SERPIND1 siRNA

20-abx933010
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HEK-293T Telomerase Over-Expressing Cell Pellet

abx069991-1Pellet 1 Pellet
EUR 398
  • Shipped within 1-3 working days.

SERPIND1 Blocking Peptide

33R-9813 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SERPIND1 antibody, catalog no. 70R-5267

SERPIND1 Conjugated Antibody

C33086 100ul
EUR 397

SERPIND1 cloning plasmid

CSB-CL021080HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1500
  • Sequence: atgaaacactcattaaacgcacttctcattttcctcatcataacatctgcgtggggtgggagcaaaggcccgctggatcagctagagaaaggaggggaaactgctcagtctgcagatccccagtgggagcagttaaataacaaaaacctgagcatgcctcttctccctgccgact
  • Show more
Description: A cloning plasmid for the SERPIND1 gene.

SERPIND1 Rabbit pAb

A5848-100ul 100 ul
EUR 308

SERPIND1 Rabbit pAb

A5848-200ul 200 ul
EUR 459

SERPIND1 Rabbit pAb

A5848-20ul 20 ul
EUR 183

SERPIND1 Rabbit pAb

A5848-50ul 50 ul
EUR 223

anti- SERPIND1 antibody

FNab07750 100µg
EUR 548.75
  • Immunogen: serpin peptidase inhibitor, clade D(heparin cofactor), member 1
  • Uniprot ID: P05546
  • Gene ID: 3053
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against SERPIND1

Anti-SERPIND1 antibody

PAab07750 100 ug
EUR 386

Anti-SERPIND1 antibody

STJ28411 100 µl
EUR 277
Description: This gene belongs to the serpin gene superfamily. Serpins play roles in many processes including inflammation, blood clotting, and cancer metastasis. Members of this family have highly conserved secondary structures with a reactive center loop that interacts with the protease active site to inhibit protease activity. This gene encodes a plasma serine protease that functions as a thrombin and chymotrypsin inhibitor. The protein is activated by heparin, dermatan sulfate, and glycosaminoglycans. Allelic variations in this gene are associated with heparin cofactor II deficiency.

Chymase reagent

30C-CP1129 5 units
EUR 2185
Description: Purified native Human Chymase reagent

Traut's Reagent

2330-1000
EUR 349

Traut's Reagent

2330-500
EUR 207

MTS Reagent

2808-1000
EUR 990

MTS Reagent

2808-250
EUR 365

MTT Reagent

2809-1G
EUR 180

MTT Reagent

2809-5G
EUR 544

BOP reagent

5-02141 25g Ask for price

BOP reagent

5-02142 100g Ask for price

Bluing Reagent

BRT030 30 ml
EUR 60

Bluing Reagent

BRT125 125 ml
EUR 63

Bluing Reagent

BRT3800 1 Gal.
EUR 184

Bluing Reagent

BRT500 500 ml
EUR 76

Bluing Reagent

BRT999 1000 ml
EUR 88

BOP reagent

A7015-100000 100 g
EUR 200
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

A7015-25000 25 g
EUR 113
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

Beaucage reagent

HY-100951 10mM/1mL
EUR 126

Bradford reagent

BDE641 100ml
EUR 61.01
  • Product category: Biochemicals/Biology Reagents/Protein Related

SERPIND1 protein (His tag)

80R-3898 100 ug
EUR 327
Description: Purified recombinant SERPIND1 protein (His tag)

Serpin D1 (SERPIND1) Antibody

20-abx004485
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serpin D1 (SERPIND1) Antibody

abx237750-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human SERPIND1 ELISA Kit

ELA-E0284h 96 Tests
EUR 824

Human SERPIND1 ELISA Kit

EH12199 96T
EUR 567.6
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P05546
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

SERPIND1 ELISA KIT|Human

EF002834 96 Tests
EUR 689

Rat SERPIND1 shRNA Plasmid

20-abx986526
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Serpin D1 (SERPIND1) Antibody

20-abx320675
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human SERPIND1 shRNA Plasmid

20-abx952078
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SERPIND1 shRNA Plasmid

20-abx970760
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Arabidopsis Thaliana Lysate

30R-AA023 150 ug
EUR 156
Description: Arabidopsis Thaliana Plant Lysate

CMV Cell Lysate

35-1867 1 mg
EUR 1835
Description: CMV enriched cell lysate

HSV1 Cell Lysate

35-1872 1 ml
EUR 394
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate

35-1873 1 ml
EUR 394
Description: HSV2 enriched cell lysate

JM109-lysate Antibody

abx234439-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21-lysate Antibody

abx230905-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

DH5a-lysate Antibody

abx232362-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Green Algae Lysate

PABL-1306 50 ug
EUR 164

BSA (Reagent Grade)

30-AB79 1 kg
EUR 1552
Description: Reagent Grade Bovine Serum Albumin (99% pure)

BSA (Reagent Grade)

30-AB81 200 grams
EUR 476
Description: Reagent Grade Sulphydryl Blocked BSA (99% pure)

Griess Reagent Kit

30100 1KIT
EUR 149
Description: Minimum order quantity: 1 unit of 1KIT

BODIPY-Acetylene Reagent

2594-1
EUR 207

BODIPY-Acetylene Reagent

2594-5
EUR 675

Industrial fish ELISA kits have a restricted capability to detect totally different fish species and their merchandise.

 

Fish is a significant meals and allergen supply, requiring declaration on packaged meals, usually ensured by using ELISAs. Over 1,000 totally different fish species are traded and consumed worldwide, increasingly offered by aquaculture. As much as 3% of the overall inhabitants are susceptible to typically deadly allergic reactions to fish, requiring strict avoidance of this meals commodity.

 

The purpose of this research is to judge the capability of three commercially out there ELISA assessments to detect all kinds of bony and cartilaginous fish and their merchandise, important to make sure dependable and protected meals labeling.The detection of 57 bony fish ranged from 26% to 61%.

SERPINI1 Antibody

CSB-PA869434-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against SERPINI1. Recognizes SERPINI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

SERPINI1 Antibody

1-CSB-PA859934LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINI1. Recognizes SERPINI1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SERPINI1 antibody

70R-5263 50 ug
EUR 467
Description: Rabbit polyclonal SERPINI1 antibody

SERPINI1 Antibody

1-CSB-PA021089GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SERPINI1. Recognizes SERPINI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SERPINI1 siRNA

20-abx904882
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SERPINI1 siRNA

20-abx933024
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SERPINI1 siRNA

20-abx933025
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human SERPINI1 shRNA Plasmid

20-abx953523
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SERPINI1 Polyclonal Antibody

29393-100ul 100ul
EUR 252

SERPINI1 Polyclonal Antibody

29393-50ul 50ul
EUR 187

SERPINI1 Rabbit pAb

A15703-100ul 100 ul
EUR 308

SERPINI1 Rabbit pAb

A15703-200ul 200 ul
EUR 459

SERPINI1 Rabbit pAb

A15703-20ul 20 ul
EUR 183

SERPINI1 Rabbit pAb

A15703-50ul 50 ul
EUR 223

SERPINI1 Blocking Peptide

33R-1340 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ST6GALNAC6 antibody, catalog no. 70R-8664

Neuroserpin (SERPINI1) Antibody

abx025697-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody

abx025697-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody

20-abx115478
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody

20-abx123763
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody

abx235681-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Neuroserpin (SERPINI1) Antibody

abx332186-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody

abx433030-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Neuroserpin (SERPINI1) Antibody

20-abx301904
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SERPINI1 cloning plasmid

CSB-CL859934HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1233
  • Sequence: atggctttccttggactcttctctttgctggttctgcaaagtatggctacaggggccactttccctgaggaagccattgctgacttgtcagtgaatatgtataatcgtcttagagccactggtgaagatgaaaatattctcttctctccattgagtattgctcttgcaatgggaa
  • Show more
Description: A cloning plasmid for the SERPINI1 gene.

SERPINI1 Rabbit pAb

A8833-100ul 100 ul
EUR 308

SERPINI1 Rabbit pAb

A8833-200ul 200 ul
EUR 459

SERPINI1 Rabbit pAb

A8833-20ul 20 ul Ask for price

SERPINI1 Rabbit pAb

A8833-50ul 50 ul Ask for price

pBluescriptR-SERPINI1 Plasmid

PVTB00940 2 ug
EUR 356

Anti-SERPINI1 antibody

STJ111439 100 µl
EUR 277
Description: This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The protein is primarily secreted by axons in the brain, and preferentially reacts with and inhibits tissue-type plasminogen activator. It is thought to play a role in the regulation of axonal growth and the development of synaptic plasticity. Mutations in this gene result in familial encephalopathy with neuroserpin inclusion bodies (FENIB), which is a dominantly inherited form of familial encephalopathy and epilepsy characterized by the accumulation of mutant neuroserpin polymers. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-SERPINI1 antibody

STJ118163 100 µl
EUR 277

Recombinant Human SerpinI1/ Neuroserpin Protein, Untagged, E.coli-100ug

QP10160-ec-100ug 100ug
EUR 988

Recombinant Human SerpinI1/ Neuroserpin Protein, Untagged, E.coli-250ug

QP10160-ec-250ug 250ug
EUR 1731

Recombinant Human SerpinI1/ Neuroserpin Protein, Untagged, E.coli-25ug

QP10160-ec-25ug 25ug
EUR 290

Recombinant Human SerpinI1/ Neuroserpin Protein, Untagged, E.coli-5ug

QP10160-ec-5ug 5ug
EUR 154

Human Neuroserpin, SERPINI1 ELISA KIT

ELI-36796h 96 Tests
EUR 824

SERPINI1 ORF Vector (Human) (pORF)

ORF009401 1.0 ug DNA
EUR 95

SERPINI1 ELISA Kit (Human) (OKCD01254)

OKCD01254 96 Wells
EUR 831
Description: Description of target: Serine protease inhibitor that inhibits plasminogen activators and plasmin but not thrombin. May be involved in the formation or reorganization of synaptic connections as well as for synaptic plasticity in the adult nervous system. May protect neurons from cell damage by tissue-type plasminogen activator. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.34 ng/mL

SERPINI1 Antibody, HRP conjugated

1-CSB-PA859934LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINI1. Recognizes SERPINI1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SERPINI1 Antibody, FITC conjugated

1-CSB-PA859934LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINI1. Recognizes SERPINI1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SERPINI1 Antibody, Biotin conjugated

1-CSB-PA859934LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINI1. Recognizes SERPINI1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse SERPINI1 shRNA Plasmid

20-abx972851
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SERPINI1 shRNA Plasmid

20-abx987244
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SERPINI1 Polyclonal Conjugated Antibody

C29393 100ul
EUR 397

Neuroserpin (SERPINI1) Antibody (HRP)

20-abx317628
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody (FITC)

20-abx317629
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody (Biotin)

20-abx317630
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Neuroserpin/SERPINI1 Antibody

PB9744 100ug/vial
EUR 294

SERPINI1 sgRNA CRISPR Lentivector set (Human)

K2126601 3 x 1.0 ug
EUR 339

ELISA kit for Human Neuroserpin (SERPINI1)

KTE60688-48T 48T
EUR 332
  • Serine protease inhibitors of the serpin superfamily are involved in many cellular processes. Neuroserpin was first identified as a protein secreted from the axons of dorsal root ganglion neurons. It is a member of the serpin superfamily of serine pr
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Neuroserpin (SERPINI1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Neuroserpin (SERPINI1)

KTE60688-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Serine protease inhibitors of the serpin superfamily are involved in many cellular processes. Neuroserpin was first identified as a protein secreted from the axons of dorsal root ganglion neurons. It is a member of the serpin superfamily of serine pr
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Neuroserpin (SERPINI1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Neuroserpin (SERPINI1)

KTE60688-96T 96T
EUR 539
  • Serine protease inhibitors of the serpin superfamily are involved in many cellular processes. Neuroserpin was first identified as a protein secreted from the axons of dorsal root ganglion neurons. It is a member of the serpin superfamily of serine pr
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Neuroserpin (SERPINI1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Neuroserpin, Serpini1 ELISA KIT

ELI-45671m 96 Tests
EUR 865

Polyclonal SERPINI1 Antibody (N-term)

APR13292G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SERPINI1 (N-term). This antibody is tested and proven to work in the following applications:

Chicken Neuroserpin, SERPINI1 ELISA KIT

ELI-38297c 96 Tests
EUR 928

Serpini1 ORF Vector (Rat) (pORF)

ORF076094 1.0 ug DNA
EUR 506

Serpini1 ORF Vector (Mouse) (pORF)

ORF057067 1.0 ug DNA
EUR 506

SERPINI1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2126602 1.0 ug DNA
EUR 154

SERPINI1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2126603 1.0 ug DNA
EUR 154

SERPINI1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2126604 1.0 ug DNA
EUR 154

SERPINI1 Protein Vector (Human) (pPB-C-His)

PV037601 500 ng
EUR 329

SERPINI1 Protein Vector (Human) (pPB-N-His)

PV037602 500 ng
EUR 329

SERPINI1 Protein Vector (Human) (pPM-C-HA)

PV037603 500 ng
EUR 329

Frequent European and North American species together with carp, cod, and salmon species demonstrated the next detection fee as in comparison with these from the Asia-Pacific, including pangasius and several other mackerel and tuna species. Among the many 17 canned bony fish merchandise, solely 65% to 86% had been detected, with tuna exhibiting the bottom fee.

 

Not one of the cartilaginous fish (n=9) as properly as different vertebrates (n=8) or shellfish (n=5) were detected.We show a restricted capability of three business fish ELISA kits to detect fish and their merchandise.

ELISA equipment for Human Neuroserpin (SERPINI1)

The complexity of fish as an rising utilized protein supply raises the pressing want for improved detection methods, essential for the meals trade to supply protected seafood merchandise and adjust to worldwide legislations. This text is protected by copyright. All rights reserved.

 

  • Onchocerca lupi is an emerging zoonotic parasite of canines, endemic to the southwestern USA and areas of the Previous World. At present, there aren’t any particular serological diagnostic assessments in a position to detect O. lupi an infection. Current literature has demonstrated that commercially out there heartworm antigen assessments, regardless of being extremely delicate, could cross-react with infections by different filarid nematodes.

 

  • There is no such thing as a info on potential cross-reactivity of such assessments in serum of canines contaminated with O. lupi. Our goal was to evaluate serum samples of canines naturally-infected with O. lupi for potential cross-reactivity before and after heat-treatment utilizing a business heartworm ELISA equipment.

 

  • We obtained serum from 23 canines naturally-infected with O. lupi. These canines offered with ocular illness, and had been consulted to schedule both surgical removal of ocular nodules because of an infection or enucleation. Samples had been examined in triplicate utilizing the DiroCHEK® Heartworm Antigen Check equipment (Synbiotics Company, Zoetis, Kalamazoo, MI, USA) following the producers’ protocol pre- and post-heat-treatment. Samples had been heat-treated utilizing a dry warmth block at 103 °C for 10 min after which centrifuged at 1818×g for 20 min.

         Hen Neuroserpin, SERPINI1 ELISA KIT

  • Out of a complete of 23 canines, 19 (82.6 %) had no antigen detected no matter heat-treatment, three canines examined constructive earlier than and after heat-treatment, and a single canine turned constructive after heat-treatment. These three canines that had been constructive earlier than and after heat-treatment had been affirmedly co-infected with Dirofilaria immitis by the veterinarians answerable for these instances, and we had been unable to get the historical past or observe up with the canine that turned constructive post-heat-treatment solely.

 

  • Our information recommend that O. lupi infections shouldn’t end in false-positives when utilizing the DiroCHEK® in canine serum, earlier than or after heat-treatment. Canines with medical ocular onchocercosis that check antigen-positive in DiroCHEK® are seemingly co-infected with D. immitis, and must be additional examined, including analysis of microfilariae in blood and diagnostic imaging. If heartworm an infection is confirmed, the animals must be enrolled within the beneficial remedy protocol in accordance to the rules of the American Heartworm Society or different native organizations.