The Inhibitory Effect of 6-Gingerol on Ubiquitin-Specific Peptidase 14 Enhances Autophagy-Dependent Ferroptosis and Anti-Tumor in vivo and in vitro

The Inhibitory Effect of 6-Gingerol on Ubiquitin-Specific Peptidase 14 Enhances Autophagy-Dependent Ferroptosis and Anti-Tumor in vivo and in vitro

December 22, 2020 0 By Keith

Lung most cancers is the most typical malignant tumor and is the main reason for cancer-related deaths worldwide. Extraction of bioactive substances from herbs is taken into account in its place methodology to conventional remedy. 6-Gingerol is a naturally occurring phenol present in ginger that can be utilized to deal with tumors and suppress irritation.

To find out whether or not 6-Gingerol can be utilized as a therapeutic agent for tumors. On this research, tumor-bearing mice had been used as an animal mannequin and A549 as a cell mannequin. Western blot was used to detect the expression of autophagy associated proteins ubiquitin-specific peptidase 14 (USP14), Beclin1, microtubule-associated protein mild chain 3 (LC3) and ferroptosis associated proteins nuclear receptor coactivator 4 (NCOA4), ferritin heavy chain 1 (FTH1), transferrin receptor 1 (TfR1), glutathione peroxidase 4 (GPX4), activating transcription factor4 (ATF4) in vivo and in vitro. MTT and EdU had been used to detect the viability of A549 cells. H&E and immunofluorescence had been used to localize and detect the expression of proteins.

The detection of reactive oxygen species was carried out utilizing fluorescence probes. It was discovered that the administration of 6-Gingerol decreased the expression of USP14, vastly elevated the variety of autophagosomes, reactive oxygen species (ROS) and iron focus, decreased the survival and proliferation charge of A549 cells, and considerably decreased tumor quantity and weight. The outcomes point out that 6-Gingerol inhibits lung most cancers cell progress by way of suppression of USP14 expression and its downstream regulation of autophagy-dependent ferroptosis, revealing the perform and efficacy of 6-Gingerol as a therapeutic compound in A549 and its attainable mechanism of motion.

 

Arachidonic Acid Is a Secure and Efficacious Schistosomicide, and an Endoschistosomicide in Pure and Experimental Infections, and Cysteine Peptidase Vaccinated Hosts

Blood flukes of the genus Schistosoma are coated by a protecting heptalaminated, double lipid bilayer floor membrane. Giant quantities of sphingomyelin (SM) within the outer leaflet kind with surrounding water molecules a good hydrogen bond barrier, which permits entry of vitamins and prevents entry of host immune effectors. Extreme hydrolysis of SM to phosphoryl choline and ceramide by way of activation of the parasite tegument-associated impartial sphingomyelinase (nSMase) with the polyunsaturated fatty acid, arachidonic acid (ARA) results in parasite demise, by way of permitting publicity of apical membrane antigens to antibody-dependent cell-mediated cytotoxicity (ADCC), and accumulation of the pro-apoptotic ceramide.
Floor membrane nSMase represents, thus, a worm Achilles heel, and ARA a legitimate schistosomicide. A number of experiments carried out in vitro utilizing larval, juvenile, and grownup Schistosoma mansoni and Schistosoma haematobium documented ARA schistosomicidal potential. Arachidonic acid schistosomicidal motion was proven to be secure and efficacious in mice and hamsters contaminated with S. mansoni and S. haematobium, respectively, and in kids with mild S. mansoni an infection. A mix of praziquantel and ARA led to excellent remedy charges in kids with heavy S. mansoni an infection. Moreover, ample proof was obtained for the highly effective ARA ovocidal potential in vivo and in vitro in opposition to S. mansoni and S. haematobium liver and gut eggs. Research documented ARA as an endogenous schistosomicide within the ultimate mammalian and intermediate snail hosts, and in mice and hamsters, immunized with the cysteine peptidase-based vaccine.
These findings collectively help our advocating the nutrient ARA because the secure and efficacious schistosomicide of the long run. Endovascular and open thoraco-abdominal aortic aneurysm (TAAA) restore is related to particular problems. Circulating dipeptidyl peptidase 3 (cDPP3) is a novel biomarker that reveals a powerful affiliation with organ failure which has not been assessed in surgical settings. Subsequently, the target of this research was to evaluate the prognostic capabilities of cDPP3 for predicting affected person survival and organ failure following open and endovascular TAAA restore.
 The Inhibitory Effect of 6-Gingerol on Ubiquitin-Specific Peptidase 14 Enhances Autophagy-Dependent Ferroptosis and Anti-Tumor in vivo and in vitro

The Inhibitory Effect of 6-Gingerol on Ubiquitin-Specific Peptidase 14 Enhances Autophagy-Dependent Ferroptosis and Anti-Tumor in vivo and in vitro

Meta-Evaluation of 11 Heterogeneous Research concerning Dipeptidyl Peptidase Four Inhibitor Add-On Remedy for Sort 2 Diabetes Mellitus Sufferers Handled with Insulin

Background: A number of scientific trials have addressed the therapeutic technique of including dipeptidyl peptidase 4 (DPP-4) inhibitors to the remedy of sort 2 diabetes mellitus (DM) inadequately managed by insulin remedy. Nonetheless, there’s a excessive diploma of heterogeneity in these research, and the reason for which has not been recognized.
Strategies: We carried out a meta-analysis of randomized managed trials, which in contrast the efficacy and security of including DPP-Four inhibitors or placebo to insulin remedy; the extent of hemoglobin A1c  within the sufferers was >7.0%, and the period of remedy was ≥eight weeks. We centered on the imply adjustments in HbA1c from the baseline and the incidence of hypoglycemia. We assumed that 5 baseline parameters (HbA1c, fasting blood glucose, physique mass index (BMI), period of sort 2 DM, and period of remedy) might have an effect on ΔHbA1c. Concerning the incidence of hypoglycemia, we suspected that the heterogeneity was attributable to variations within the definition of hypoglycemia among the many research.
Outcomes: Knowledge obtained from 11 research had been included within the evaluation. The imply ΔHbA1c between the DPP-Four inhibitor and placebo teams was -0.61% . There was substantial heterogeneity among the many 11 research, however 74.1% of this variability was defined by the distinction in BMI. The chances ratio for the incidence of hypoglycemia was 1.02, with substantial heterogeneity as a result of variations within the definition of hypoglycemia among the many research. There was no obvious impact of publication bias.

Anti-Neuroserpin/SERPINI1 Antibody

PB9744 100ug/vial
EUR 294

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

SERPINI1 antibody

70R-5263 50 ug
EUR 467
Description: Rabbit polyclonal SERPINI1 antibody

SERPINI1 antibody

70R-20183 50 ul
EUR 435
Description: Rabbit polyclonal SERPINI1 antibody

SERPINI1 Antibody

CSB-PA869434-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against SERPINI1. Recognizes SERPINI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

SERPINI1 Antibody

CSB-PA869434-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against SERPINI1. Recognizes SERPINI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

SERPINI1 Antibody

1-CSB-PA859934LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINI1. Recognizes SERPINI1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SERPINI1 Antibody

1-CSB-PA021089GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SERPINI1. Recognizes SERPINI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Serpini1/ Rat Serpini1 ELISA Kit

ELI-13820r 96 Tests
EUR 886

Neuroserpin (SERPINI1) Antibody

20-abx123763
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody

20-abx115478
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody

abx025697-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody

abx025697-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody

abx332186-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody

abx433030-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Neuroserpin (SERPINI1) Antibody

abx235681-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Neuroserpin (SERPINI1) Antibody

20-abx301904
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SERPINI1 Polyclonal Antibody

29393-100ul 100ul
EUR 252

SERPINI1 Polyclonal Antibody

29393-50ul 50ul
EUR 187

SERPINI1 siRNA

20-abx904882
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SERPINI1 siRNA

20-abx933024
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SERPINI1 siRNA

20-abx933025
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SERPINI1 Polyclonal Conjugated Antibody

C29393 100ul
EUR 397

Neuroserpin (SERPINI1) Antibody (HRP)

20-abx317628
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody (FITC)

20-abx317629
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroserpin (SERPINI1) Antibody (Biotin)

20-abx317630
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SERPINI1 Antibody, HRP conjugated

1-CSB-PA859934LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINI1. Recognizes SERPINI1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SERPINI1 Antibody, FITC conjugated

1-CSB-PA859934LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINI1. Recognizes SERPINI1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SERPINI1 Antibody, Biotin conjugated

1-CSB-PA859934LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINI1. Recognizes SERPINI1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SERPINI1 Rabbit pAb

A15703-100ul 100 ul
EUR 308

SERPINI1 Rabbit pAb

A15703-200ul 200 ul
EUR 459

SERPINI1 Rabbit pAb

A15703-20ul 20 ul
EUR 183

SERPINI1 Rabbit pAb

A15703-50ul 50 ul
EUR 223

SERPINI1 Rabbit pAb

A8833-100ul 100 ul
EUR 308

SERPINI1 Rabbit pAb

A8833-200ul 200 ul
EUR 459

SERPINI1 Rabbit pAb

A8833-20ul 20 ul Ask for price

SERPINI1 Rabbit pAb

A8833-50ul 50 ul Ask for price

SERPINI1 Blocking Peptide

33R-1340 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ST6GALNAC6 antibody, catalog no. 70R-8664

SERPINI1 cloning plasmid

CSB-CL859934HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1233
  • Sequence: atggctttccttggactcttctctttgctggttctgcaaagtatggctacaggggccactttccctgaggaagccattgctgacttgtcagtgaatatgtataatcgtcttagagccactggtgaagatgaaaatattctcttctctccattgagtattgctcttgcaatgggaa
  • Show more
Description: A cloning plasmid for the SERPINI1 gene.

pBluescriptR-SERPINI1 Plasmid

PVTB00940 2 ug
EUR 356

Polyclonal SERPINI1 Antibody (N-term)

APR13292G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SERPINI1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Rat SERPINI1 shRNA Plasmid

20-abx987244
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SERPINI1 shRNA Plasmid

20-abx953523
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SERPINI1 shRNA Plasmid

20-abx972851
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal SERPINI1 Antibody (monoclonal) (M01), Clone: 1D10

APR13270G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human SERPINI1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D10. This antibody is applicable in WB and IHC, E

Monoclonal SERPINI1 Antibody (monoclonal) (M03), Clone: 1E11

APR13291G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human SERPINI1 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1E11. This antibody is applicable in WB, E

Human Neuroserpin, SERPINI1 ELISA KIT

ELI-36796h 96 Tests
EUR 824

Mouse Neuroserpin, Serpini1 ELISA KIT

ELI-45671m 96 Tests
EUR 865

Chicken Neuroserpin, SERPINI1 ELISA KIT

ELI-38297c 96 Tests
EUR 928

SERPINI1 ORF Vector (Human) (pORF)

ORF009401 1.0 ug DNA
EUR 95

Serpini1 ORF Vector (Mouse) (pORF)

ORF057067 1.0 ug DNA
EUR 506

Serpini1 ORF Vector (Rat) (pORF)

ORF076094 1.0 ug DNA
EUR 506

SERPINI1 ELISA Kit (Human) (OKCD01254)

OKCD01254 96 Wells
EUR 831
Description: Description of target: Serine protease inhibitor that inhibits plasminogen activators and plasmin but not thrombin. May be involved in the formation or reorganization of synaptic connections as well as for synaptic plasticity in the adult nervous system. May protect neurons from cell damage by tissue-type plasminogen activator. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.34 ng/mL

SERPINI1 sgRNA CRISPR Lentivector set (Human)

K2126601 3 x 1.0 ug
EUR 339

Serpini1 sgRNA CRISPR Lentivector set (Mouse)

K3771501 3 x 1.0 ug
EUR 339

ELISA kit for Human Neuroserpin (SERPINI1)

KTE60688-48T 48T
EUR 332
  • Serine protease inhibitors of the serpin superfamily are involved in many cellular processes. Neuroserpin was first identified as a protein secreted from the axons of dorsal root ganglion neurons. It is a member of the serpin superfamily of serine pr
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Neuroserpin (SERPINI1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Neuroserpin (SERPINI1)

KTE60688-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Serine protease inhibitors of the serpin superfamily are involved in many cellular processes. Neuroserpin was first identified as a protein secreted from the axons of dorsal root ganglion neurons. It is a member of the serpin superfamily of serine pr
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Neuroserpin (SERPINI1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Neuroserpin (SERPINI1)

KTE60688-96T 96T
EUR 539
  • Serine protease inhibitors of the serpin superfamily are involved in many cellular processes. Neuroserpin was first identified as a protein secreted from the axons of dorsal root ganglion neurons. It is a member of the serpin superfamily of serine pr
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Neuroserpin (SERPINI1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Serpini1 sgRNA CRISPR Lentivector set (Rat)

K6996601 3 x 1.0 ug
EUR 339

p3*Flag-CMV-14-SERPINI1 Plasmid

PVTB00940-2a 2 ug
EUR 356

SERPINI1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2126602 1.0 ug DNA
EUR 154

SERPINI1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2126603 1.0 ug DNA
EUR 154

SERPINI1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2126604 1.0 ug DNA
EUR 154

Serpini1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3771502 1.0 ug DNA
EUR 154

Serpini1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3771503 1.0 ug DNA
EUR 154

Serpini1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3771504 1.0 ug DNA
EUR 154

Serpini1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6996602 1.0 ug DNA
EUR 154

Serpini1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6996603 1.0 ug DNA
EUR 154

Serpini1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6996604 1.0 ug DNA
EUR 154

SERPINI1 Protein Vector (Human) (pPB-C-His)

PV037601 500 ng
EUR 329

SERPINI1 Protein Vector (Human) (pPB-N-His)

PV037602 500 ng
EUR 329

SERPINI1 Protein Vector (Human) (pPM-C-HA)

PV037603 500 ng
EUR 329

SERPINI1 Protein Vector (Human) (pPM-C-His)

PV037604 500 ng
EUR 329

SERPINI1 Protein Vector (Rat) (pPB-C-His)

PV304374 500 ng
EUR 603

SERPINI1 Protein Vector (Rat) (pPB-N-His)

PV304375 500 ng
EUR 603

SERPINI1 Protein Vector (Rat) (pPM-C-HA)

PV304376 500 ng
EUR 603

SERPINI1 Protein Vector (Rat) (pPM-C-His)

PV304377 500 ng
EUR 603

SERPINI1 Protein Vector (Mouse) (pPB-C-His)

PV228266 500 ng
EUR 603

SERPINI1 Protein Vector (Mouse) (pPB-N-His)

PV228267 500 ng
EUR 603

SERPINI1 Protein Vector (Mouse) (pPM-C-HA)

PV228268 500 ng
EUR 603

SERPINI1 Protein Vector (Mouse) (pPM-C-His)

PV228269 500 ng
EUR 603

Serpini1 3'UTR GFP Stable Cell Line

TU168648 1.0 ml Ask for price

SERPINI1 3'UTR Luciferase Stable Cell Line

TU022979 1.0 ml
EUR 1394

Serpini1 3'UTR Luciferase Stable Cell Line

TU118648 1.0 ml Ask for price

SERPINI1 3'UTR GFP Stable Cell Line

TU072979 1.0 ml
EUR 1394

Serpini1 3'UTR Luciferase Stable Cell Line

TU220193 1.0 ml Ask for price

Serpini1 3'UTR GFP Stable Cell Line

TU270193 1.0 ml Ask for price

SERPINI1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV691297 1.0 ug DNA
EUR 682

SERPINI1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV691301 1.0 ug DNA
EUR 682

SERPINI1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV691302 1.0 ug DNA
EUR 682

Recombinant Human SerpinI1/ Neuroserpin Protein, Untagged, E.coli-100ug

QP10160-ec-100ug 100ug
EUR 988

Recombinant Human SerpinI1/ Neuroserpin Protein, Untagged, E.coli-250ug

QP10160-ec-250ug 250ug
EUR 1731

Recombinant Human SerpinI1/ Neuroserpin Protein, Untagged, E.coli-25ug

QP10160-ec-25ug 25ug
EUR 290

Recombinant Human SerpinI1/ Neuroserpin Protein, Untagged, E.coli-5ug

QP10160-ec-5ug 5ug
EUR 154

SERPINI1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2126605 3 x 1.0 ug
EUR 376

Serpini1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3771505 3 x 1.0 ug
EUR 376

Serpini1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6996605 3 x 1.0 ug
EUR 376

SERPINI1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2126606 1.0 ug DNA
EUR 167

SERPINI1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2126607 1.0 ug DNA
EUR 167

SERPINI1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2126608 1.0 ug DNA
EUR 167

Serpini1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3771506 1.0 ug DNA
EUR 167

Serpini1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3771507 1.0 ug DNA
EUR 167

Serpini1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3771508 1.0 ug DNA
EUR 167

SERPINI1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV691298 1.0 ug DNA
EUR 682

SERPINI1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV691299 1.0 ug DNA
EUR 740

SERPINI1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV691300 1.0 ug DNA
EUR 740

Serpini1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6996606 1.0 ug DNA
EUR 167

Serpini1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6996607 1.0 ug DNA
EUR 167

Serpini1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6996608 1.0 ug DNA
EUR 167

SERPINI1 Serpin Peptidase Inhibitor, Clade I Member 1 Human Recombinant Protein

PROTQ99574 Regular: 20ug
EUR 317
Description: SERPINI1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 395 amino acids and having a total molecular mass of 44.6kDa.;SERPINI1 is purified by proprietary chromatographic techniques.

SERPINI1 Human, Serpin Peptidase Inhibitor, Clade I Member 1 Human Recombinant Protein, His Tag

PROTQ99574-1 Regular: 10ug
EUR 317
Description: SERPINI1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (a.a 17-410) containing 404 amino acids and including a 10 a.a N-terminal His tag. The total molecular mass is 45.9kDa (calculated).

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277
Conclusions: The addition of DPP-Four inhibitors to insulin remedy for grownup sufferers with sort 2 DM can considerably cut back HbA1c ranges with out growing the incidence of hypoglycemia. BMI and hypoglycemia definition might clarify the heterogeneity within the scientific trials. This trial is registered with PROSPERO