Top ELISA kit for Human Glia-derived nexin

Top ELISA kit for Human Glia-derived nexin

Cyclic Nucleotide (cAMP and cGMP) Assays and Seize ELISA for Quantitative Evaluation of Plasmodium falciparum Blood-stage Egress.

 

  • Upon rupture of Plasmodium falciparum (P. falciparum) schizonts in vitro (an occasion generally known as egress), merozoites are launched into the tradition medium. The merozoites invade recent crimson blood cells, a course of that entails shedding of a microneme protein referred to as apical membrane antigen-1 (AMA1) from the merozoite floor.

 

  • This shedding, which takes place even within the absence of invasion, is due to this fact a surrogate marker for the diploma of egress happening in a tradition, and might be measured utilizing a selected seize ELISA to quantify AMA1 ranges in tradition supernatants (Collins et al., 2013).

        Mouse Glia-derived nexin(SERPINE2) ELISA equipment

  • The assay makes use of a monoclonal antibody particular for AMA1 (referred to as 4G2dc1) (Kocken et al., 1998; Collins et al., 2009) to seize and immobilize the protein from tradition supernatants, then uses a selected rabbit polyclonal antiserum to detect the immobilized antigen.

 

 

  • A phosphatase-conjugated goat anti-rabbit antibody is lastly used to quantify the binding of the second antibody. Egress is totally dependent upon the exercise of a parasite cGMP-dependent protein kinase, PKG, and so is influenced by ranges of intracellular cGMP (Collins et al., 2013).

 

 

  • That is regulated by the interaction between guanylate cyclases and phosphodiesterases. The latter enzymes can also degrade cAMP, so it could even be informative to measure intracellular cAMP ranges.

 

Rat Glia-derived nexin(SERPINE2) ELISA kit

1-CSB-EL021082RA
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Glia-derived nexin(SERPINE2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Glia Derived Nexin (SERPINE2) ELISA Kit

abx256958-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Glia-derived nexin (SERPINE2)

1-CSB-EP021082HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 57.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glia-derived nexin(SERPINE2) expressed in E.coli

Glia Derived Nexin (SERPINE2) Antibody

abx026914-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Glia Derived Nexin (SERPINE2) Antibody

abx026914-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Glia Derived Nexin (SERPINE2) Antibody

20-abx004074
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glia Derived Nexin (SERPINE2) Antibody

20-abx115474
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glia Derived Nexin (SERPINE2) Antibody

abx122030-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Glia Derived Nexin (SERPINE2) Antibody

abx237751-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Glia Derived Nexin (SERPINE2) Antibody

abx237752-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Glia Derived Nexin (SERPINE2) Antibody

20-abx241290
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glia Derived Nexin (SERPINE2) Antibody

20-abx241918
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Glia-derived nexin(SERPINE2) ELISA kit

CSB-EL021082HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Glia-derived nexin (SERPINE2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Glia-derived nexin(SERPINE2) ELISA kit

1-CSB-EL021082HU
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Glia-derived nexin(SERPINE2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Glia-derived nexin(SERPINE2) ELISA kit

CSB-EL021082MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Glia-derived nexin (SERPINE2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Glia-derived nexin(SERPINE2) ELISA kit

1-CSB-EL021082MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Glia-derived nexin(SERPINE2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Glia Derived Nexin (SERPINE2) ELISA Kit

abx254122-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Glia Derived Nexin (SERPINE2) ELISA Kit

abx252530-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Glia- derived nexin, SERPINE2 ELISA KIT

ELI-31100h 96 Tests
EUR 824

Mouse Glia- derived nexin, Serpine2 ELISA KIT

ELI-27274m 96 Tests
EUR 865

ELISA kit for Human Glia-derived nexin (SERPINE2)

KTE60693-48T 48T
EUR 332
  • Protease nexin I is a 44-kD thrombin and urokinase inhibitor released by human foreskin fibroblasts. PN-I shares several features with antithrombin III , an abundant plasma thrombin inhibitor. Both PN-I and AT-III have high affinities for heparin, an
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Glia-derived nexin (SERPINE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Glia-derived nexin (SERPINE2)

KTE60693-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Protease nexin I is a 44-kD thrombin and urokinase inhibitor released by human foreskin fibroblasts. PN-I shares several features with antithrombin III , an abundant plasma thrombin inhibitor. Both PN-I and AT-III have high affinities for heparin, an
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Glia-derived nexin (SERPINE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Glia-derived nexin (SERPINE2)

KTE60693-96T 96T
EUR 539
  • Protease nexin I is a 44-kD thrombin and urokinase inhibitor released by human foreskin fibroblasts. PN-I shares several features with antithrombin III , an abundant plasma thrombin inhibitor. Both PN-I and AT-III have high affinities for heparin, an
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Glia-derived nexin (SERPINE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat GDN(Glia Derived Nexin) ELISA Kit

ER0992 96T
EUR 524.1
  • Detection range: 6.25-400 pg/ml
  • Uniprot ID: P07092
  • Alias: GDN/GdNPF/Proteinase Nexin 1/GDNserine(or cysteine) proteinase inhibitor, clade E(nexin, plasminogenactivator inhibitor type 1), member 2/glia-derived nexin/glial-derived neurite promoting fac
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 3.75pg/ml

96-Well Plate

1996-2
EUR 104

Aligned Nanofibers 96 Well Plate

3D00012-96 700 nm-PCLs
EUR 110

Tissue Culture Plate, 96 Well

TCP20-96 1 UNIT
EUR 53.48
  • Product category: Labware/Culture Related/Culture Plates - Multiwell

ELISA kit for Rat GDN (Glia Derived Nexin)

E-EL-R2534 1 plate of 96 wells
EUR 534
  • Gentaur's GDN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat GDN. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat GDN (Glia Derived Nexin) in samples from Serum, Plasma, Cell supernatant

96 WELL PCR SEGMENTED PLATE

PCR-96-SG-C 10/pk
EUR 145
Description: PCR Plates & Tubes; A354 PCR Plate-Axygen

GDN ELISA Kit| Rat Glia Derived Nexin ELISA Kit

EF017764 96 Tests
EUR 689

Human Glia Derived Nexin (GDN) ELISA Kit

20-abx151668
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glia Derived Nexin (GDN) ELISA Kit

20-abx258751
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human GDN(Glia Derived Nexin) ELISA Kit

EH3131 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P07093
  • Alias: GDN/GdNPF/Proteinase Nexin 1/GDNserine(or cysteine) proteinase inhibitor, clade E(nexin, plasminogenactivator inhibitor type 1), member 2/glia-derived nexin/glial-derived neurite promoting fac
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse GDN(Glia Derived Nexin) ELISA Kit

EM1070 96T
EUR 524.1
  • Detection range: 6.25-400 pg/ml
  • Uniprot ID: Q07235
  • Alias: GDN/GdNPF/Proteinase Nexin 1/GDNserine(or cysteine) proteinase inhibitor, clade E(nexin, plasminogenactivator inhibitor type 1), member 2/glia-derived nexin/glial-derived neurite promoting fac
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 3.75pg/ml

Human Glia Derived Nexin ELISA Kit (GDN)

RK01454 96 Tests
EUR 521

Human Glia Derived Nexin (GDN) ELISA Kit

SED381Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Human Glia Derived Nexin (GDN) ELISA Kit

SED381Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Human Glia Derived Nexin (GDN) ELISA Kit

SED381Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Human Glia Derived Nexin (GDN) ELISA Kit

SED381Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Human Glia Derived Nexin (GDN) ELISA Kit

4-SED381Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Glia Derived Nexin elisa. Alternative names of the recognized antigen: SERPINE2
  • PI7
  • PN1
  • PNI
  • Protease Nexin I
  • Serpin Peptidase Inhibitor Clade E Member 2
  • Peptidase inhibitor 7
  • Protease nexin I
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glia Derived Nexin (GDN) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Glia Derived Nexin (GDN) Antibody

20-abx128989
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glia Derived Nexin (GDN) Antibody

20-abx172541
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Glia Derived Nexin (GDN)

4-RPD381Hu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07093
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 45.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Glia Derived Nexin expressed in: E.coli

ELISA kit for Human GDN (Glia Derived Nexin)

E-EL-H5526 1 plate of 96 wells
EUR 534
  • Gentaur's GDN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GDN. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GDN (Glia Derived Nexin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse GDN (Glia Derived Nexin)

E-EL-M2646 1 plate of 96 wells
EUR 534
  • Gentaur's GDN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse GDN. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse GDN (Glia Derived Nexin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GDN (Glia Derived Nexin)

ELK4973 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glia Derived Nexin (GDN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Glia Deri
  • Show more
Description: A sandwich ELISA kit for detection of Glia Derived Nexin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

GDN ELISA Kit| Mouse Glia Derived Nexin ELISA Kit

EF013638 96 Tests
EUR 689

Human Glia Derived Nexin (GDN) CLIA Kit

20-abx494242
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Glia Derived Nexin (GDN) CLIA Kit

20-abx496339
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Glia Derived Nexin (GDN) Protein

20-abx168202
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Polystyrene-bottomed 96-well plate (ELISA)

CT361 6
EUR 73

Adapter for 96 well plate

3510147 1unit
EUR 5581

Streptavidin coated 96-well Plate

6523-5
EUR 327

Black 96 Well Plate, 1EA

X025-1EA 1EA
EUR 73

96 well filter plate (960ul each well)

SD5006 12UNIT
EUR 96.54
  • Product category: Labware/Filtration Supplies/Filter Plates - DNA

96 WELL CLEAR PCR PLATE FOR ABI

PCR-96-AB-C 10/pk
EUR 167
Description: PCR Plates & Tubes; A354 PCR Plate-Axygen

Wide-range Human Glia Derived Nexin (GDN) ELISA Kit

WED381Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human Glia Derived Nexin (GDN) ELISA Kit

WED381Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human Glia Derived Nexin (GDN) ELISA Kit

WED381Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human Glia Derived Nexin (GDN) ELISA Kit

WED381Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

 

Proactive therapeutic drug monitoring of infliximab: a comparative examine of a brand new point-of-care quantitative take a look at with two established ELISA assays.

 

  • Therapeutic drug monitoring is a strong technique identified to enhance the scientific outcomes and to optimise the healthcare assets within the remedy of autoimmune illnesses.

 

  • At the moment, a lot of the strategies commercially out there for the quantification of infliximab (IFX) are ELISA-based, with a turnaround time of roughly eight h, and delaying the goal dosage adjustment to the next infusion.

         ELISA equipment for Human Glia-derived nexin (SERPINE2)

  • To validate the primary point-of-care IFX quantification machine out there within the market – the Quantum Blue Infliximab assay (Buhlmann, Schonenbuch, Switzerland) – by evaluating it with two well-established strategies.

 

 

  • The three strategies had been used to assay the IFX concentration of spiked samples and of the serum of 299 inflammatory bowel illnesses (IBD) sufferers present process IFX remedy.

Gene Knock-Out HR Targeting Vector [MCS1-EF1a-GFP-T2A-Puro-pA-MCS2]

HR410PA-1 10 ug
EUR 1023
  • Category: HR Donors

Gene Knock-Out HR Targeting Vector [MCS1-EF1a-RFP-T2A-Hygro-pA-MCS2]

HR510PA-1 10 ug
EUR 1023
  • Category: HR Donors

ExoStd? Lyophilized Exosome Standard (30 µg, U87 MG, 2 vials)

M1054-2
EUR 604

ExoStd? Lyophilized Exosome Standard (30 µg, U87 MG, 4 vials)

M1054-4
EUR 914

ExoStd? Lyophilized Exosome Standard (30 µg, U87 MG, 6 vials)

M1054-6
EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, U87 MG, 2 vials)

M1055-2
EUR 718

ExoStd? Lyophilized Exosome Standard (100 µg, U87 MG, 4 vials)

M1055-4
EUR 1142

ExoStd? Lyophilized Exosome Standard (100 µg, U87 MG, 6 vials)

M1055-6
EUR 1616

TARGATT? Knock-in iPSC Generation (Master Cell Line)

AST-1100 1 vial of 1X10^6 cells Ask for price
Description: 6 month

TARGATT? Knock-in Mouse Cell Line Generation Kit (Master Cell Line)

AST-7001 1 Kit Ask for price
Description: 6 month

MG-BSA Control

STA-306 100 µg
EUR 322
Description:
  • Methylglyoxal-BSA (MG-BSA) may be used as a positive control. 100 µg at 1 mg/mL in PBS.
  • Provided at 1 mg/mL

Serpinb9 3'UTR Luciferase Stable Cell Line

TU118632 1.0 ml Ask for price

Serpinb9 3'UTR GFP Stable Cell Line

TU168632 1.0 ml Ask for price

Serpinb9 3'UTR Luciferase Stable Cell Line

TU220182 1.0 ml Ask for price

Serpinb9 3'UTR GFP Stable Cell Line

TU270182 1.0 ml Ask for price

SERPINB9 3'UTR GFP Stable Cell Line

TU072964 1.0 ml
EUR 1521

SERPINB9 3'UTR Luciferase Stable Cell Line

TU022964 1.0 ml
EUR 1521

TARGATT? Knock-in CHO Generation Kit (Master Cell Line)

AST-1200 1 Kit Ask for price
Description: 12 month

TARGATT? Knock-in HEK293 Generation Kit (Master Cell Line)

AST-1300 1 Kit Ask for price
Description: 12 month

Basic HR Targeting Vector [MCS1-LoxP-MCS2-MCS3-pA-LoxP-MCS4] for Gene Knock-In/Out

HR100PA-1 10 ug
EUR 938
  • Category: HR Donors

SERPINB9 antibody

70R-20177 50 ul
EUR 435
Description: Rabbit polyclonal SERPINB9 antibody

SERPINB9 Antibody

35037-100ul 100ul
EUR 252

SERPINB9 Antibody

35037-50ul 50ul
EUR 187

SERPINB9 antibody

38873-100ul 100ul
EUR 252

SERPINB9 Antibody

1-CSB-PA003772
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SERPINB9. Recognizes SERPINB9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

SERPINB9 Antibody

CSB-PA065366-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SERPINB9. Recognizes SERPINB9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

SERPINB9 Antibody

CSB-PA065366-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SERPINB9. Recognizes SERPINB9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

SERPINB9 Antibody

DF4493 200ul
EUR 304
Description: SERPINB9 Antibody detects endogenous levels of total SERPINB9.

SERPINB9 Antibody

1-CSB-PA021077ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SERPINB9. Recognizes SERPINB9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

SERPINB9 Antibody

1-CSB-PA021077GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SERPINB9. Recognizes SERPINB9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SERPINB9 siRNA

20-abx933006
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SERPINB9 Antibody

ABD4493 100 ug
EUR 438

anti-SerpinB9

YF-PA13782 50 ul
EUR 363
Description: Mouse polyclonal to SerpinB9

anti-SerpinB9

YF-PA24369 50 ul
EUR 334
Description: Mouse polyclonal to SerpinB9

293AD Cell Line

AD-100 1 vial
EUR 461
Description: The 293AD Cell Line is derived from the parental 293 cells but selected for attributes that increase adenovirus production, including firmer attachment and larger surface area.

293AAV Cell Line

AAV-100 1 vial
EUR 508
Description: The 293AAV Cell Line is derived from the parental 293 cells but selected for attributes that increase AAV production, including firmer attachment and larger surface area.

293LTV Cell Line

LTV-100 1 vial
EUR 508
Description: The 293LTV Cell Line is derived from the parental 293 cells but selected for attributes that increase lentiviral production, including fimrer attachment and larger surface area.

293RTV Cell Line

RV-100 1 vial
EUR 508
Description: The 293RTV Cell Line is derived from the parental 293 cells but selected for attributes that increase retroviral production, including fimrer attachment and larger surface area.

OxiSelect Methylglyoxal (MG) Competitive ELISA Kit

STA-811 96 assays
EUR 798
Description: The OxiSelect Methylglyoxal (MG) ELISA Kit is an enzyme immunoassay developed for rapid detection and quantitation of MG-H1 (methyl-glyoxal-hydro-imidazolone) protein adducts.  The quantity of MG adduct in protein samples is determined by comparing its absorbance with that of a known MG-BSA standard curve.  Each kit provides sufficient reagents to perform up to 96 assays, including standard curve and unknown protein samples.

OxiSelect Methylglyoxal (MG) Competitive ELISA Kit

STA-811-5 5 x 96 assays
EUR 3240
Description: The OxiSelect Methylglyoxal (MG) ELISA Kit is an enzyme immunoassay developed for rapid detection and quantitation of MG-H1 (methyl-glyoxal-hydro-imidazolone) protein adducts.  The quantity of MG adduct in protein samples is determined by comparing its absorbance with that of a known MG-BSA standard curve.  Each kit provides sufficient reagents to perform up to 96 assays, including standard curve and unknown protein samples.

SERPINB9 sgRNA CRISPR Lentivector set (Human)

K2125001 3 x 1.0 ug
EUR 339

Microplate Swing-Out Centrifuge

abx725026-1Unit 1 Unit
EUR 1476
  • Shipped within 10-15 working days.

Clinical Swing-Out Centrifuge

abx725027-1Unit 1 Unit
EUR 1476
  • Shipped within 10-15 working days.

Gene Knock-Out HR Targeting Vector w/Single Selection Marker (Blasticidin) and Negative Selection (TK) Against Random Integration

HR720PA-1 10 µg
EUR 1145
  • Category: HR Donors

Human Serpin B9 (SERPINB9)

1-CSB-EP021077HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 69.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Serpin B9(SERPINB9) expressed in E.coli

SERPINB9 ELISA KIT|Human

EF002833 96 Tests
EUR 689

Human SERPINB9 shRNA Plasmid

20-abx953521
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

293/GFP Cell Line

AKR-200 1 vial
EUR 572
Description: 293/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

T47D/GFP Cell Line

AKR-208 1 vial
EUR 572
Description: T47D/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

A549/GFP Cell Line

AKR-209 1 vial
EUR 572
Description: A549/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

HeLa/GFP Cell Line

AKR-213 1 vial
EUR 572
Description: HeLa/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/GFP Cell Line

AKR-214 1 vial
EUR 572
Description: NIH3T3/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/Cas9 Cell Line

AKR-5104 1 vial
EUR 572

293/Cas9 Cell Line

AKR-5110 1 vial
EUR 572

HeLa/Cas9 Cell Line

AKR-5111 1 vial
EUR 572

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (GFP+Puro) and Negative Selection (TK) Against Random Integration

HR700PA-1 10 µg
EUR 1145
  • Category: HR Donors

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (RFP+Hygro) and Negative Selection (TK) Against Random Integration

HR710PA-1 10 µg
EUR 1145
  • Category: HR Donors

SKOV-3/Luc Cell Line

AKR-232 1 vial
EUR 572
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

MCF-7/Luc Cell Line

AKR-234 1 vial
EUR 572
Description: MCF-7/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

OVCAR-5/RFP Cell Line

AKR-254 1 vial
EUR 572
Description: OVCAR-5/RFP Cell Line stably expresses RFP and otherwise exhibits the same characteristics of the parental cell line.

SERPINB9 Blocking Peptide

DF4493-BP 1mg
EUR 195

SERPINB9 Conjugated Antibody

C35037 100ul
EUR 397

SERPINB9 cloning plasmid

CSB-CL021077HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1131
  • Sequence: atggaaactctttctaatgcaagtggtacttttgccatacgccttttaaagatactgtgtcaagataacccttcgcacaacgtgttctgttctcctgtgagcatctcctctgccctggccatggttctcctaggggcaaagggaaacaccgcaacccagatggcccaggcactgt
  • Show more
Description: A cloning plasmid for the SERPINB9 gene.

SERPINB9 Rabbit pAb

A6393-100ul 100 ul
EUR 308

SERPINB9 Rabbit pAb

A6393-200ul 200 ul
EUR 459

SERPINB9 Rabbit pAb

A6393-20ul 20 ul
EUR 183

SERPINB9 Rabbit pAb

A6393-50ul 50 ul
EUR 223

anti- SERPINB9 antibody

FNab07749 100µg
EUR 548.75
  • Immunogen: serpin peptidase inhibitor, clade B(ovalbumin), member 9
  • Uniprot ID: P50453
  • Gene ID: 5272
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against SERPINB9

Anti-SERPINB9 antibody

PAab07749 100 ug
EUR 386

Anti-SERPINB9 antibody

STJ28476 100 µl
EUR 277
Description: This gene encodes a member of the serine protease inhibitor family which are also known as serpins. The encoded protein belongs to a subfamily of intracellular serpins. This protein inhibits the activity of the effector molecule granzyme B. Overexpression of this protein may prevent cytotoxic T-lymphocytes from eliminating certain tumor cells. A pseudogene of this gene is found on chromosome 6.

Anti-SERPINB9 antibody

STJ71136 100 µg
EUR 359

Anti-SerpinB9 (1F5)

YF-MA14703 100 ug
EUR 363
Description: Mouse monoclonal to SerpinB9

SERPINB9 sgRNA CRISPR Lentivector (Human) (Target 1)

K2125002 1.0 ug DNA
EUR 154

SERPINB9 sgRNA CRISPR Lentivector (Human) (Target 2)

K2125003 1.0 ug DNA
EUR 154

SERPINB9 sgRNA CRISPR Lentivector (Human) (Target 3)

K2125004 1.0 ug DNA
EUR 154

Gene Knock-Out HR Targeting Vector with TK selection [MCS1-LoxP-EF1?-GFP-T2A-Puro-P2A-hsvTK-pA-LoxP-MCS2]

HR210PA-1 10 ug
EUR 1145
  • Category: HR Donors

SERPINB9 ORF Vector (Human) (pORF)

ORF009391 1.0 ug DNA
EUR 95

SERPINB9 ELISA Kit (Human) (OKCD00387)

OKCD00387 96 Wells
EUR 831
Description: Description of target: Granzyme B inhibitor. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.058 ng/mL

Serpinb9 sgRNA CRISPR Lentivector set (Rat)

K7334601 3 x 1.0 ug
EUR 339

Serpinb9 sgRNA CRISPR Lentivector set (Mouse)

K3339001 3 x 1.0 ug
EUR 339

Platinum-E Retroviral Packaging Cell Line, Ecotropic

RV-101 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-E cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-A Retroviral Packaging Cell Line, Amphotropic

RV-102 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-A cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-GP Retroviral Packaging Cell Line, Pantropic

RV-103 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-GP cells contain the gag and pol genes required for retroviral packaging; an expression vector is co-transfected with a VSVG envelope vector.

TARGATT? Knock-in iPSC Genotyping Kit

AST-1102 1 Kit Ask for price
Description: 12 month

Polyclonal SERPINB9 Antibody (Center)

APR04495G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SERPINB9 (Center). This antibody is tested and proven to work in the following applications:

Serpin B9 (SERPINB9) Antibody

20-abx008866
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Serpin B9 (SERPINB9) Antibody

20-abx004888
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serpin B9 (SERPINB9) Antibody

20-abx014874
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Serpin B9 (SERPINB9) Antibody

20-abx115472
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
  • The purpose-of-care assay had a mean IFX restoration of 92%, being essentially the most exact among the many examined strategies. The Intraclass Correlation Coefficients of the point-of-care IFX assay vs. the 2 ELISA-based established strategies had been 0.889 and 0.939.

          Gene Knock-Out HR Concentrating on Vector [MCS1-EF1a-GFP-T2A-Puro-pA-MCS2]

  • Furthermore, the accuracy of the point-of-care IFX in contrast with every of the 2 reference strategies was 77% and 83%, and the kappa statistics revealed a considerable settlement (0.648 and 0.738).

 

  • The Quantum Blue IFX assay can successfully substitute the generally used ELISA-based IFX quantification kits. This point-of-care IFX assay is ready to ship the outcomes inside 15 min makes it superb for an instantaneous goal focus adjusted dosing. Furthermore, it’s a user-friendly desktop machine that doesn’t require particular laboratory services or extremely specialised personnel.