Top ELISA kit for Human Glia-derived nexin

Cyclic Nucleotide (cAMP and cGMP) Assays and Seize ELISA for Quantitative Evaluation of Plasmodium falciparum Blood-stage Egress.

 

• Upon rupture of Plasmodium falciparum (P. falciparum) schizonts in vitro (an occasion generally known as egress), merozoites are launched into the tradition medium. The merozoites invade recent crimson blood cells, a course of that entails shedding of a microneme protein referred to as apical membrane antigen-1 (AMA1) from the merozoite floor.

 

• This shedding, which takes place even within the absence of invasion, is due to this fact a surrogate marker for the diploma of egress happening in a tradition, and might be measured utilizing a selected seize ELISA to quantify AMA1 ranges in tradition supernatants (Collins et al., 2013).

        Mouse Glia-derived nexin(SERPINE2) ELISA equipment

• The assay makes use of a monoclonal antibody particular for AMA1 (referred to as 4G2dc1) (Kocken et al., 1998; Collins et al., 2009) to seize and immobilize the protein from tradition supernatants, then uses a selected rabbit polyclonal antiserum to detect the immobilized antigen.

 

 

• A phosphatase-conjugated goat anti-rabbit antibody is lastly used to quantify the binding of the second antibody. Egress is totally dependent upon the exercise of a parasite cGMP-dependent protein kinase, PKG, and so is influenced by ranges of intracellular cGMP (Collins et al., 2013).

 

 

• That is regulated by the interaction between guanylate cyclases and phosphodiesterases. The latter enzymes can also degrade cAMP, so it could even be informative to measure intracellular cAMP ranges.

 

Rat Glia-derived nexin(SERPINE2) ELISA kit
1-CSB-EL021082RA	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Glia-derived nexin(SERPINE2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Glia Derived Nexin (SERPINE2) ELISA Kit
abx256958-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Glia-derived nexin (SERPINE2)
1-CSB-EP021082HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 57.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glia-derived nexin(SERPINE2) expressed in E.coli

Glia Derived Nexin (SERPINE2) Antibody
abx026914-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Glia Derived Nexin (SERPINE2) Antibody
abx026914-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Glia Derived Nexin (SERPINE2) Antibody
20-abx004074	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Glia Derived Nexin (SERPINE2) Antibody
20-abx115474	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Glia Derived Nexin (SERPINE2) Antibody
abx122030-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Glia Derived Nexin (SERPINE2) Antibody
abx237751-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Glia Derived Nexin (SERPINE2) Antibody
abx237752-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Glia Derived Nexin (SERPINE2) Antibody
20-abx241290	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Glia Derived Nexin (SERPINE2) Antibody
20-abx241918	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human Glia-derived nexin(SERPINE2) ELISA kit
CSB-EL021082HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Glia-derived nexin (SERPINE2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Glia-derived nexin(SERPINE2) ELISA kit
1-CSB-EL021082HU	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Glia-derived nexin(SERPINE2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Glia-derived nexin(SERPINE2) ELISA kit
CSB-EL021082MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Glia-derived nexin (SERPINE2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Glia-derived nexin(SERPINE2) ELISA kit
1-CSB-EL021082MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Glia-derived nexin(SERPINE2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Glia Derived Nexin (SERPINE2) ELISA Kit
abx254122-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Glia Derived Nexin (SERPINE2) ELISA Kit
abx252530-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Glia- derived nexin, SERPINE2 ELISA KIT
ELI-31100h	Lifescience Market	96 Tests	EUR 824

Mouse Glia- derived nexin, Serpine2 ELISA KIT
ELI-27274m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Human Glia-derived nexin (SERPINE2)
KTE60693-48T	Abbkine	48T	EUR 332
Protease nexin I is a 44-kD thrombin and urokinase inhibitor released by human foreskin fibroblasts. PN-I shares several features with antithrombin III , an abundant plasma thrombin inhibitor. Both PN-I and AT-III have high affinities for heparin, an Show more
Description: Quantitative sandwich ELISA for measuring Human Glia-derived nexin (SERPINE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Glia-derived nexin (SERPINE2)
KTE60693-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Protease nexin I is a 44-kD thrombin and urokinase inhibitor released by human foreskin fibroblasts. PN-I shares several features with antithrombin III , an abundant plasma thrombin inhibitor. Both PN-I and AT-III have high affinities for heparin, an Show more
Description: Quantitative sandwich ELISA for measuring Human Glia-derived nexin (SERPINE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Glia-derived nexin (SERPINE2)
KTE60693-96T	Abbkine	96T	EUR 539
Protease nexin I is a 44-kD thrombin and urokinase inhibitor released by human foreskin fibroblasts. PN-I shares several features with antithrombin III , an abundant plasma thrombin inhibitor. Both PN-I and AT-III have high affinities for heparin, an Show more
Description: Quantitative sandwich ELISA for measuring Human Glia-derived nexin (SERPINE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat GDN(Glia Derived Nexin) ELISA Kit
ER0992	FN Test	96T	EUR 524.1
Detection range: 6.25-400 pg/ml Uniprot ID: P07092 Alias: GDN/GdNPF/Proteinase Nexin 1/GDNserine(or cysteine) proteinase inhibitor, clade E(nexin, plasminogenactivator inhibitor type 1), member 2/glia-derived nexin/glial-derived neurite promoting fac Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 3.75pg/ml

96-Well Plate
1996-2	Biovision		EUR 104

Aligned Nanofibers 96 Well Plate
3D00012-96	Neuromics	700 nm-PCLs	EUR 110

Tissue Culture Plate, 96 Well
TCP20-96	Bio Basic	1 UNIT	EUR 53.48
Product category: Labware/Culture Related/Culture Plates - Multiwell

ELISA kit for Rat GDN (Glia Derived Nexin)
E-EL-R2534	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GDN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat GDN. Standards or samples are added to the micro ELISA plate wells and combined with the sp Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat GDN (Glia Derived Nexin) in samples from Serum, Plasma, Cell supernatant

96 WELL PCR SEGMENTED PLATE
PCR-96-SG-C	CORNING	10/pk	EUR 145
Description: PCR Plates & Tubes; A354 PCR Plate-Axygen

GDN ELISA Kit| Rat Glia Derived Nexin ELISA Kit
EF017764	Lifescience Market	96 Tests	EUR 689

Human Glia Derived Nexin (GDN) ELISA Kit
20-abx151668	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Glia Derived Nexin (GDN) ELISA Kit
20-abx258751	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human GDN(Glia Derived Nexin) ELISA Kit
EH3131	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: P07093 Alias: GDN/GdNPF/Proteinase Nexin 1/GDNserine(or cysteine) proteinase inhibitor, clade E(nexin, plasminogenactivator inhibitor type 1), member 2/glia-derived nexin/glial-derived neurite promoting fac Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse GDN(Glia Derived Nexin) ELISA Kit
EM1070	FN Test	96T	EUR 524.1
Detection range: 6.25-400 pg/ml Uniprot ID: Q07235 Alias: GDN/GdNPF/Proteinase Nexin 1/GDNserine(or cysteine) proteinase inhibitor, clade E(nexin, plasminogenactivator inhibitor type 1), member 2/glia-derived nexin/glial-derived neurite promoting fac Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 3.75pg/ml

Human Glia Derived Nexin ELISA Kit (GDN)
RK01454	Abclonal	96 Tests	EUR 521

Human Glia Derived Nexin (GDN) ELISA Kit
SED381Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Human Glia Derived Nexin (GDN) ELISA Kit
SED381Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Human Glia Derived Nexin (GDN) ELISA Kit
SED381Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Human Glia Derived Nexin (GDN) ELISA Kit
SED381Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Human Glia Derived Nexin (GDN) ELISA Kit
4-SED381Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Glia Derived Nexin elisa. Alternative names of the recognized antigen: SERPINE2 PI7 PN1 PNI Protease Nexin I Serpin Peptidase Inhibitor Clade E Member 2 Peptidase inhibitor 7 Protease nexin I
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glia Derived Nexin (GDN) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Glia Derived Nexin (GDN) Antibody
20-abx128989	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glia Derived Nexin (GDN) Antibody
20-abx172541	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Glia Derived Nexin (GDN)
4-RPD381Hu01	Cloud-Clone	EUR 490.66 EUR 234.00 EUR 1564.96 EUR 588.32 EUR 1076.64 EUR 391.00 EUR 3762.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P07093 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 45.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Glia Derived Nexin expressed in: E.coli

ELISA kit for Human GDN (Glia Derived Nexin)
E-EL-H5526	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GDN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GDN. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GDN (Glia Derived Nexin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse GDN (Glia Derived Nexin)
E-EL-M2646	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GDN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse GDN. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse GDN (Glia Derived Nexin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GDN (Glia Derived Nexin)
ELK4973	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glia Derived Nexin (GDN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Glia Deri Show more
Description: A sandwich ELISA kit for detection of Glia Derived Nexin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

GDN ELISA Kit| Mouse Glia Derived Nexin ELISA Kit
EF013638	Lifescience Market	96 Tests	EUR 689

Human Glia Derived Nexin (GDN) CLIA Kit
20-abx494242	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Glia Derived Nexin (GDN) CLIA Kit
20-abx496339	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Glia Derived Nexin (GDN) Protein
20-abx168202	Abbexa	EUR 690.00 EUR 286.00 EUR 2110.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Polystyrene-bottomed 96-well plate (ELISA)
CT361	U-CyTech	6	EUR 73

Adapter for 96 well plate
3510147	Atto	1unit	EUR 5581

Streptavidin coated 96-well Plate
6523-5	Biovision		EUR 327

Black 96 Well Plate, 1EA
X025-1EA	Arbor Assays	1EA	EUR 73

96 well filter plate (960ul each well)
SD5006	Bio Basic	12UNIT	EUR 96.54
Product category: Labware/Filtration Supplies/Filter Plates - DNA

96 WELL CLEAR PCR PLATE FOR ABI
PCR-96-AB-C	CORNING	10/pk	EUR 167
Description: PCR Plates & Tubes; A354 PCR Plate-Axygen

Wide-range Human Glia Derived Nexin (GDN) ELISA Kit
WED381Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human Glia Derived Nexin (GDN) ELISA Kit
WED381Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human Glia Derived Nexin (GDN) ELISA Kit
WED381Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human Glia Derived Nexin (GDN) ELISA Kit
WED381Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human Glia Derived Nexin (GDN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human Glia Derived Nexin (GDN) in serum, plasma, tissue homogenates and other biological fluids.

 

 

• Therapeutic drug monitoring is a strong technique identified to enhance the scientific outcomes and to optimise the healthcare assets within the remedy of autoimmune illnesses.

 

• At the moment, a lot of the strategies commercially out there for the quantification of infliximab (IFX) are ELISA-based, with a turnaround time of roughly eight h, and delaying the goal dosage adjustment to the next infusion.

         ELISA equipment for Human Glia-derived nexin (SERPINE2)

• To validate the primary point-of-care IFX quantification machine out there within the market – the Quantum Blue Infliximab assay (Buhlmann, Schonenbuch, Switzerland) – by evaluating it with two well-established strategies.

 

 

• The three strategies had been used to assay the IFX concentration of spiked samples and of the serum of 299 inflammatory bowel illnesses (IBD) sufferers present process IFX remedy.

Gene Knock-Out HR Targeting Vector [MCS1-EF1a-GFP-T2A-Puro-pA-MCS2]
HR410PA-1	SBI	10 ug	EUR 1023
Category: HR Donors

Gene Knock-Out HR Targeting Vector [MCS1-EF1a-RFP-T2A-Hygro-pA-MCS2]
HR510PA-1	SBI	10 ug	EUR 1023
Category: HR Donors

ExoStd? Lyophilized Exosome Standard (30 µg, U87 MG, 2 vials)
M1054-2	Biovision		EUR 604

ExoStd? Lyophilized Exosome Standard (30 µg, U87 MG, 4 vials)
M1054-4	Biovision		EUR 914

ExoStd? Lyophilized Exosome Standard (30 µg, U87 MG, 6 vials)
M1054-6	Biovision		EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, U87 MG, 2 vials)
M1055-2	Biovision		EUR 718

ExoStd? Lyophilized Exosome Standard (100 µg, U87 MG, 4 vials)
M1055-4	Biovision		EUR 1142

ExoStd? Lyophilized Exosome Standard (100 µg, U87 MG, 6 vials)
M1055-6	Biovision		EUR 1616

TARGATT? Knock-in iPSC Generation (Master Cell Line)
AST-1100	Applied StemCell	1 vial of 1X10^6 cells	Ask for price
Description: 6 month

TARGATT? Knock-in Mouse Cell Line Generation Kit (Master Cell Line)
AST-7001	Applied StemCell	1 Kit	Ask for price
Description: 6 month

MG-BSA Control
STA-306	Cell Biolabs	100 µg	EUR 322
Description: Methylglyoxal-BSA (MG-BSA) may be used as a positive control. 100 µg at 1 mg/mL in PBS. Provided at 1 mg/mL

Serpinb9 3'UTR Luciferase Stable Cell Line
TU118632	ABM	1.0 ml	Ask for price

Serpinb9 3'UTR GFP Stable Cell Line
TU168632	ABM	1.0 ml	Ask for price

Serpinb9 3'UTR Luciferase Stable Cell Line
TU220182	ABM	1.0 ml	Ask for price

Serpinb9 3'UTR GFP Stable Cell Line
TU270182	ABM	1.0 ml	Ask for price

SERPINB9 3'UTR GFP Stable Cell Line
TU072964	ABM	1.0 ml	EUR 1521

SERPINB9 3'UTR Luciferase Stable Cell Line
TU022964	ABM	1.0 ml	EUR 1521

TARGATT? Knock-in CHO Generation Kit (Master Cell Line)
AST-1200	Applied StemCell	1 Kit	Ask for price
Description: 12 month

TARGATT? Knock-in HEK293 Generation Kit (Master Cell Line)
AST-1300	Applied StemCell	1 Kit	Ask for price
Description: 12 month

Basic HR Targeting Vector [MCS1-LoxP-MCS2-MCS3-pA-LoxP-MCS4] for Gene Knock-In/Out
HR100PA-1	SBI	10 ug	EUR 938
Category: HR Donors

SERPINB9 antibody
70R-20177	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SERPINB9 antibody

SERPINB9 Antibody
35037-100ul	SAB	100ul	EUR 252

SERPINB9 Antibody
35037-50ul	SAB	50ul	EUR 187

SERPINB9 antibody
38873-100ul	SAB	100ul	EUR 252

SERPINB9 Antibody
1-CSB-PA003772	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SERPINB9. Recognizes SERPINB9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

SERPINB9 Antibody
CSB-PA065366-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against SERPINB9. Recognizes SERPINB9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

SERPINB9 Antibody
CSB-PA065366-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against SERPINB9. Recognizes SERPINB9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

SERPINB9 Antibody
DF4493	Affbiotech	200ul	EUR 304
Description: SERPINB9 Antibody detects endogenous levels of total SERPINB9.

SERPINB9 Antibody
1-CSB-PA021077ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SERPINB9. Recognizes SERPINB9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

SERPINB9 Antibody
1-CSB-PA021077GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SERPINB9. Recognizes SERPINB9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SERPINB9 siRNA
20-abx933006	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SERPINB9 Antibody
ABD4493	Lifescience Market	100 ug	EUR 438

anti-SerpinB9
YF-PA13782	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to SerpinB9

anti-SerpinB9
YF-PA24369	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to SerpinB9

293AD Cell Line
AD-100	Cell Biolabs	1 vial	EUR 461
Description: The 293AD Cell Line is derived from the parental 293 cells but selected for attributes that increase adenovirus production, including firmer attachment and larger surface area.

293AAV Cell Line
AAV-100	Cell Biolabs	1 vial	EUR 508
Description: The 293AAV Cell Line is derived from the parental 293 cells but selected for attributes that increase AAV production, including firmer attachment and larger surface area.

293LTV Cell Line
LTV-100	Cell Biolabs	1 vial	EUR 508
Description: The 293LTV Cell Line is derived from the parental 293 cells but selected for attributes that increase lentiviral production, including fimrer attachment and larger surface area.

293RTV Cell Line
RV-100	Cell Biolabs	1 vial	EUR 508
Description: The 293RTV Cell Line is derived from the parental 293 cells but selected for attributes that increase retroviral production, including fimrer attachment and larger surface area.

OxiSelect Methylglyoxal (MG) Competitive ELISA Kit
STA-811	Cell Biolabs	96 assays	EUR 798
Description: The OxiSelect Methylglyoxal (MG) ELISA Kit is an enzyme immunoassay developed for rapid detection and quantitation of MG-H1 (methyl-glyoxal-hydro-imidazolone) protein adducts.  The quantity of MG adduct in protein samples is determined by comparing its absorbance with that of a known MG-BSA standard curve.  Each kit provides sufficient reagents to perform up to 96 assays, including standard curve and unknown protein samples.

OxiSelect Methylglyoxal (MG) Competitive ELISA Kit
STA-811-5	Cell Biolabs	5 x 96 assays	EUR 3240
Description: The OxiSelect Methylglyoxal (MG) ELISA Kit is an enzyme immunoassay developed for rapid detection and quantitation of MG-H1 (methyl-glyoxal-hydro-imidazolone) protein adducts.  The quantity of MG adduct in protein samples is determined by comparing its absorbance with that of a known MG-BSA standard curve.  Each kit provides sufficient reagents to perform up to 96 assays, including standard curve and unknown protein samples.

SERPINB9 sgRNA CRISPR Lentivector set (Human)
K2125001	ABM	3 x 1.0 ug	EUR 339

Microplate Swing-Out Centrifuge
abx725026-1Unit	Abbexa	1 Unit	EUR 1476
Shipped within 10-15 working days.

Clinical Swing-Out Centrifuge
abx725027-1Unit	Abbexa	1 Unit	EUR 1476
Shipped within 10-15 working days.

Gene Knock-Out HR Targeting Vector w/Single Selection Marker (Blasticidin) and Negative Selection (TK) Against Random Integration
HR720PA-1	SBI	10 µg	EUR 1145
Category: HR Donors

Human Serpin B9 (SERPINB9)
1-CSB-EP021077HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 69.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Serpin B9(SERPINB9) expressed in E.coli

SERPINB9 ELISA KIT|Human
EF002833	Lifescience Market	96 Tests	EUR 689

Human SERPINB9 shRNA Plasmid
20-abx953521	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

293/GFP Cell Line
AKR-200	Cell Biolabs	1 vial	EUR 572
Description: 293/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

T47D/GFP Cell Line
AKR-208	Cell Biolabs	1 vial	EUR 572
Description: T47D/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

A549/GFP Cell Line
AKR-209	Cell Biolabs	1 vial	EUR 572
Description: A549/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

HeLa/GFP Cell Line
AKR-213	Cell Biolabs	1 vial	EUR 572
Description: HeLa/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/GFP Cell Line
AKR-214	Cell Biolabs	1 vial	EUR 572
Description: NIH3T3/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/Cas9 Cell Line
AKR-5104	Cell Biolabs	1 vial	EUR 572

293/Cas9 Cell Line
AKR-5110	Cell Biolabs	1 vial	EUR 572

HeLa/Cas9 Cell Line
AKR-5111	Cell Biolabs	1 vial	EUR 572

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (GFP+Puro) and Negative Selection (TK) Against Random Integration
HR700PA-1	SBI	10 µg	EUR 1145
Category: HR Donors

Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (RFP+Hygro) and Negative Selection (TK) Against Random Integration
HR710PA-1	SBI	10 µg	EUR 1145
Category: HR Donors

SKOV-3/Luc Cell Line
AKR-232	Cell Biolabs	1 vial	EUR 572
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

MCF-7/Luc Cell Line
AKR-234	Cell Biolabs	1 vial	EUR 572
Description: MCF-7/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

OVCAR-5/RFP Cell Line
AKR-254	Cell Biolabs	1 vial	EUR 572
Description: OVCAR-5/RFP Cell Line stably expresses RFP and otherwise exhibits the same characteristics of the parental cell line.

SERPINB9 Blocking Peptide
DF4493-BP	Affbiotech	1mg	EUR 195

SERPINB9 Conjugated Antibody
C35037	SAB	100ul	EUR 397

SERPINB9 cloning plasmid
CSB-CL021077HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1131 Sequence: atggaaactctttctaatgcaagtggtacttttgccatacgccttttaaagatactgtgtcaagataacccttcgcacaacgtgttctgttctcctgtgagcatctcctctgccctggccatggttctcctaggggcaaagggaaacaccgcaacccagatggcccaggcactgt Show more
Description: A cloning plasmid for the SERPINB9 gene.

SERPINB9 Rabbit pAb
A6393-100ul	Abclonal	100 ul	EUR 308

SERPINB9 Rabbit pAb
A6393-200ul	Abclonal	200 ul	EUR 459

SERPINB9 Rabbit pAb
A6393-20ul	Abclonal	20 ul	EUR 183

SERPINB9 Rabbit pAb
A6393-50ul	Abclonal	50 ul	EUR 223

anti- SERPINB9 antibody
FNab07749	FN Test	100µg	EUR 548.75
Immunogen: serpin peptidase inhibitor, clade B(ovalbumin), member 9 Uniprot ID: P50453 Gene ID: 5272 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against SERPINB9

Anti-SERPINB9 antibody
PAab07749	Lifescience Market	100 ug	EUR 386

Anti-SERPINB9 antibody
STJ28476	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the serine protease inhibitor family which are also known as serpins. The encoded protein belongs to a subfamily of intracellular serpins. This protein inhibits the activity of the effector molecule granzyme B. Overexpression of this protein may prevent cytotoxic T-lymphocytes from eliminating certain tumor cells. A pseudogene of this gene is found on chromosome 6.

Anti-SERPINB9 antibody
STJ71136	St John's Laboratory	100 µg	EUR 359

Anti-SerpinB9 (1F5)
YF-MA14703	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SerpinB9

SERPINB9 sgRNA CRISPR Lentivector (Human) (Target 1)
K2125002	ABM	1.0 ug DNA	EUR 154

SERPINB9 sgRNA CRISPR Lentivector (Human) (Target 2)
K2125003	ABM	1.0 ug DNA	EUR 154

SERPINB9 sgRNA CRISPR Lentivector (Human) (Target 3)
K2125004	ABM	1.0 ug DNA	EUR 154

Gene Knock-Out HR Targeting Vector with TK selection [MCS1-LoxP-EF1?-GFP-T2A-Puro-P2A-hsvTK-pA-LoxP-MCS2]
HR210PA-1	SBI	10 ug	EUR 1145
Category: HR Donors

SERPINB9 ORF Vector (Human) (pORF)
ORF009391	ABM	1.0 ug DNA	EUR 95

SERPINB9 ELISA Kit (Human) (OKCD00387)
OKCD00387	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Granzyme B inhibitor. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.058 ng/mL

Serpinb9 sgRNA CRISPR Lentivector set (Rat)
K7334601	ABM	3 x 1.0 ug	EUR 339

Serpinb9 sgRNA CRISPR Lentivector set (Mouse)
K3339001	ABM	3 x 1.0 ug	EUR 339

Platinum-E Retroviral Packaging Cell Line, Ecotropic
RV-101	Cell Biolabs	1 vial	EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-E cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-A Retroviral Packaging Cell Line, Amphotropic
RV-102	Cell Biolabs	1 vial	EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-A cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-GP Retroviral Packaging Cell Line, Pantropic
RV-103	Cell Biolabs	1 vial	EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-GP cells contain the gag and pol genes required for retroviral packaging; an expression vector is co-transfected with a VSVG envelope vector.

TARGATT? Knock-in iPSC Genotyping Kit
AST-1102	Applied StemCell	1 Kit	Ask for price
Description: 12 month

Polyclonal SERPINB9 Antibody (Center)
APR04495G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SERPINB9 (Center). This antibody is tested and proven to work in the following applications:

Serpin B9 (SERPINB9) Antibody
20-abx008866	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Serpin B9 (SERPINB9) Antibody
20-abx004888	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Serpin B9 (SERPINB9) Antibody
20-abx014874	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Serpin B9 (SERPINB9) Antibody
20-abx115472	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

• The purpose-of-care assay had a mean IFX restoration of 92%, being essentially the most exact among the many examined strategies. The Intraclass Correlation Coefficients of the point-of-care IFX assay vs. the 2 ELISA-based established strategies had been 0.889 and 0.939.

          Gene Knock-Out HR Concentrating on Vector [MCS1-EF1a-GFP-T2A-Puro-pA-MCS2]

• Furthermore, the accuracy of the point-of-care IFX in contrast with every of the 2 reference strategies was 77% and 83%, and the kappa statistics revealed a considerable settlement (0.648 and 0.738).

 

• The Quantum Blue IFX assay can successfully substitute the generally used ELISA-based IFX quantification kits. This point-of-care IFX assay is ready to ship the outcomes inside 15 min makes it superb for an instantaneous goal focus adjusted dosing. Furthermore, it’s a user-friendly desktop machine that doesn’t require particular laboratory services or extremely specialised personnel.