Autophagy Is Poor and Could also be Negatively Regulated by SERPINB3 in Center Ear Cholesteatoma
-
Speculation: Whereas autophagy has been linked to numerous human illnesses, whether or not it additionally performs a job in cholesteatoma is nearly unknown. This research aimed to analyze the exercise and regulation of autophagy in cholesteatoma.
Background: The remedy of center ear cholesteatoma has been difficult attributable to an inadequate understanding of the underlying illness mechanism.
Human Serpin Peptidase Inhibitor Clade B Member 12(SERPINB12)ELISA Ki
BACKGROUND
The event of an correct methodology for number of high-quality embryos is crucial to attain excessive being pregnant charges with single embryo switch in human IVF. The developmental competence of the oocyte is acquired throughout follicle maturation and robust communication additionally exists between the follicular cells (FCs) and the oocytes; thus oocyte developmental competence could also be decided by markers expressed within the surrounding FCs.
METHODS
From consenting sufferers (n = 40), FCs have been recovered on a per follicle foundation by particular person follicle puncture. Hybridization analyses utilizing a custom-made complementary DNA microarray containing granulosa/cumulus expressed sequence tags (ESTs) from subtracted libraries and an Affymetrix GeneChip have been pershaped to determine particular genes expressed in follicles resulting in a being pregnant. The chosen candidate genes have been validated by quantitative-PCR (Q-PCR).
RESULTS
Subtractive libraries ready from pooled samples representing pregnant versus non-pregnant sufferers produced 1694 ESTs. Hybridization information evaluation discriminated 115 genes related to competent follicles. Chosen candidates have been confirmed by Q-PCR: 3-beta-hydroxysteroid dehydrogenase 1 (P = 0.0078), Ferredoxin 1 (P = 0.0203), Serine (or cysteine) proteinase inhibitor clade E member 2 (P = 0.0499), Cytochrome P450 aromatase (P = 0.0359) and Cell division cycle 42 (P = 0.0396).
SERPINB8 Serpin Peptidase Inhibitor, Clade B Member 8Human Recombinant Protein
CONCLUSIONS
Microarray applied sciences are helpful to mine the transcriptome of FCs expressed in follicles related to competent oocytes and might be used to enhance embryo choice with the target of profitable single embryo switch.
ELISA Kit) Human Serpin Peptidase Inhibitor Clade B Member 12(SERPINB12)ELISA Kit |
|
QY-E01430 |
Qayee Biotechnology |
96T |
EUR 361 |
, Member 5 (SERPINB5) ELISA) Human serpin Peptidase Inhibitor, Clade B (Ovalbumin), Member 5 (SERPINB5) ELISA |
|
QY-E05296 |
Qayee Biotechnology |
96T |
EUR 361 |
 Serpin Peptidase Inhibitor, Clade B Member 5 Antibody |
|
20-abx137426 |
Abbexa |
-
EUR 704.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 Serpin Peptidase Inhibitor, Clade B Member 5 Protein |
|
20-abx261349 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Serpin Peptidase Inhibitor, Clade B Member 5 Protein |
|
20-abx261443 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 Serpin Peptidase Inhibitor, Clade B Member 2 Protein |
|
20-abx262724 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 polyclonal antibody) Serine proteinase inhibitor clade B member 12 (SERPINB12) polyclonal antibody |
|
ABP-PAB-10285 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Proteases
- Brand:
|
 Recombinant Human Serpin Peptidase Inhibitor, Clade B Member 5 |
|
7-06376 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Serpin Peptidase Inhibitor, Clade B Member 5 |
|
7-06377 |
CHI Scientific |
25µg |
Ask for price |
Recombinant Human Serpin Peptidase Inhibitor, Clade B Member 5 |
|
7-06378 |
CHI Scientific |
1mg |
Ask for price |
 SERPINB8 Serpin Peptidase Inhibitor, Clade B Member 8Human Recombinant Protein |
|
PROTP50452 |
BosterBio |
Regular: 20ug |
EUR 317 |
 Polyclonal Antibody (Human)) Serpin Peptidase Inhibitor, Clade B, Member 4 (SERPINB4) Polyclonal Antibody (Human) |
|
4-PAA159Hu03 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg144~Thr298
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
 Serpin Peptidase Inhibitor, Clade G Member 1 Protein |
|
20-abx260636 |
Abbexa |
-
EUR 230.00
-
EUR 3084.00
-
EUR 328.00
|
|
- Shipped within 5-10 working days.
|
 Serpin Peptidase Inhibitor, Clade C Member 1 Protein |
|
20-abx261271 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 Serpin Peptidase Inhibitor, Clade D Member 1 Protein |
|
20-abx261353 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 Serpin Peptidase Inhibitor, Clade I Member 1 Protein |
|
20-abx261371 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 Serpin Peptidase Inhibitor, Clade A Member 8 Protein |
|
20-abx262647 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Serpin Peptidase Inhibitor, Clade I Member 1 Protein |
|
20-abx262659 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 Serpin Peptidase Inhibitor, Clade A Member 5 Protein |
|
20-abx262866 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 Recombinant Human Serpin Peptidase Inhibitor, Clade B Member 5, His Tag |
|
7-06379 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Serpin Peptidase Inhibitor, Clade B Member 5, His Tag |
|
7-06380 |
CHI Scientific |
25µg |
Ask for price |
Recombinant Human Serpin Peptidase Inhibitor, Clade B Member 5, His Tag |
|
7-06381 |
CHI Scientific |
1mg |
Ask for price |
 SERPINB4 Serpin Peptidase Inhibitor, Clade B Member 4 Human Recombinant Protein |
|
PROTP48594 |
BosterBio |
Regular: 10ug |
EUR 317 |
 SERPINB2 Serpin Peptidase Inhibitor, Clade B Member 2 Human Recombinant Protein |
|
PROTP05120 |
BosterBio |
Regular: 10ug |
EUR 317 |
 SERPINB3 Serpin Peptidase Inhibitor, Clade B Member 3 Human Recombinant Protein |
|
PROTP29508 |
BosterBio |
Regular: 20ug |
EUR 317 |
 SERPINB5 Serpin Peptidase Inhibitor, Clade B Member 5 Human Recombinant Protein |
|
PROTP36952 |
BosterBio |
Regular: 20ug |
EUR 317 |
ELISA Kit) Human Serpin Peptidase Inhibitor Clade B Member 7(SERPINB7)ELISA Kit |
|
QY-E01428 |
Qayee Biotechnology |
96T |
EUR 361 |
ELISA Kit) Human Serpin Peptidase Inhibitor Clade B Member 13(SERPINB13)ELISA Kit |
|
QY-E01429 |
Qayee Biotechnology |
96T |
EUR 361 |
ELISA Kit) Human Serpin Peptidase Inhibitor Clade B Member 11(SERPINB11)ELISA Kit |
|
QY-E01431 |
Qayee Biotechnology |
96T |
EUR 361 |
ELISA Kit) Human Serpin Peptidase Inhibitor Clade B Member 10(SERPINB10)ELISA Kit |
|
QY-E01432 |
Qayee Biotechnology |
96T |
EUR 374 |
ELISA kit) for Serpin Peptidase Inhibitor Clade B Member 10 (SERPINB10)ELISA kit |
|
SED384Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Serpin Peptidase Inhibitor Clade B Member 10 (SERPINB10) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV
- Show more
|
for Serpin Peptidase Inhibitor Clade B Member 10 (SERPINB10)ELISA kit |
|
SED384Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Serpin Peptidase Inhibitor Clade B Member 10 (SERPINB10) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV
- Show more
|
for Serpin Peptidase Inhibitor Clade B Member 10 (SERPINB10)ELISA kit |
|
SED384Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Serpin Peptidase Inhibitor Clade B Member 10 (SERPINB10) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV
- Show more
|
for Serpin Peptidase Inhibitor Clade B Member 10 (SERPINB10)ELISA kit |
|
SED384Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Serpin Peptidase Inhibitor Clade B Member 10 (SERPINB10) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV
- Show more
|
) ELISA Kit for Serpin Peptidase Inhibitor Clade B Member 10 (SERPINB10) |
|
4-SED384Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Serpin Peptidase Inhibitor Clade B Member 10 elisa. Alternative names of the recognized antigen: Bomapin
- Peptidase inhibitor 10
|
 Polyclonal Antibody (Human), APC) Serpin Peptidase Inhibitor, Clade B, Member 4 (SERPINB4) Polyclonal Antibody (Human), APC |
|
4-PAA159Hu03-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg144~Thr298
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
 Polyclonal Antibody (Human), Biotinylated) Serpin Peptidase Inhibitor, Clade B, Member 4 (SERPINB4) Polyclonal Antibody (Human), Biotinylated |
|
4-PAA159Hu03-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg144~Thr298
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
 Polyclonal Antibody (Human), Cy3) Serpin Peptidase Inhibitor, Clade B, Member 4 (SERPINB4) Polyclonal Antibody (Human), Cy3 |
|
4-PAA159Hu03-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 238.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg144~Thr298
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
 Polyclonal Antibody (Human), FITC) Serpin Peptidase Inhibitor, Clade B, Member 4 (SERPINB4) Polyclonal Antibody (Human), FITC |
|
4-PAA159Hu03-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg144~Thr298
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
 Polyclonal Antibody (Human), HRP) Serpin Peptidase Inhibitor, Clade B, Member 4 (SERPINB4) Polyclonal Antibody (Human), HRP |
|
4-PAA159Hu03-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 198.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg144~Thr298
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
 Polyclonal Antibody (Human), PE) Serpin Peptidase Inhibitor, Clade B, Member 4 (SERPINB4) Polyclonal Antibody (Human), PE |
|
4-PAA159Hu03-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg144~Thr298
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
 Recombinant Human Serpin Peptidase Inhibitor, Clade A Member 5 |
|
7-06370 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human Serpin Peptidase Inhibitor, Clade A Member 5 |
|
7-06371 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human Serpin Peptidase Inhibitor, Clade A Member 5 |
|
7-06372 |
CHI Scientific |
1mg |
Ask for price |
 Recombinant Human Serpin Peptidase Inhibitor, Clade I Member 1 |
|
7-06373 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Serpin Peptidase Inhibitor, Clade I Member 1 |
|
7-06374 |
CHI Scientific |
25µg |
Ask for price |
Recombinant Human Serpin Peptidase Inhibitor, Clade I Member 1 |
|
7-06375 |
CHI Scientific |
1mg |
Ask for price |
 Serpin Peptidase Inhibitor, Clade G Member 1, HEK Protein |
|
20-abx260517 |
Abbexa |
-
EUR 230.00
-
EUR 2569.00
-
EUR 328.00
|
|
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Human), APC-Cy7) Serpin Peptidase Inhibitor, Clade B, Member 4 (SERPINB4) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAA159Hu03-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 300.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Arg144~Thr298
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
 SERPINA9 Serpin Peptidase Inhibitor, Clade AMouse Recombinant Protein |
|
PROTQ9D7D2 |
BosterBio |
Regular: 5ug |
EUR 317 |
 CLIA Kit) Human Serpin Peptidase Inhibitor Clade A Member 1 (SERPINA1) CLIA Kit |
|
abx197672-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 SERPINA6 Serpin Peptidase Inhibitor, Clade A Member 6 Mouse Recombinant Protein |
|
PROTQ06770 |
BosterBio |
Regular: 10ug |
EUR 317 |
 SERPINF2 Serpin Peptidase Inhibitor, Clade F Member 2 Mouse Recombinant Protein |
|
PROTQ61247 |
BosterBio |
Regular: 10ug |
EUR 317 |
 SERPINI1 Serpin Peptidase Inhibitor, Clade I Member 1 Human Recombinant Protein |
|
PROTQ99574 |
BosterBio |
Regular: 20ug |
EUR 317 |
 SERPINC1 Serpin Peptidase Inhibitor, Clade C Member 1 Human Recombinant Protein |
|
PROTP01008 |
BosterBio |
Regular: 20ug |
EUR 317 |
 SERPINA8 Serpin Peptidase Inhibitor, Clade A Member 8 Human Recombinant Protein |
|
PROTP01019-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
 SERPINA5 Serpin Peptidase Inhibitor Clade A Member 5 Human Recombinant Protein |
|
PROTP05154 |
BosterBio |
Regular: 10ug |
EUR 317 |
 SERPING1 Serpin Peptidase Inhibitor, Clade G Member 1 Human Recombinant Protein |
|
PROTP05155 |
BosterBio |
Regular: 50ug |
EUR 317 |
 SERPIND1 Serpin Peptidase Inhibitor, Clade D Member 1 Human Recombinant Protein |
|
PROTP05546 |
BosterBio |
Regular: 20ug |
EUR 317 |
ELISA Kit) Human Serpin Peptidase Inhibitor Clade A Member 9(SERPINA9)ELISA Kit |
|
QY-E01433 |
Qayee Biotechnology |
96T |
EUR 374 |
 SERPINB2 Human, Serpin Peptidase Inhibitor, Clade B Member 2 Human Recombinant Protein, His Tag |
|
PROTP05120-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
 SERPINB5 Human, Serpin Peptidase Inhibitor, Clade B Member 5 Human Recombinant Protein, His tag |
|
PROTP36952-1 |
BosterBio |
Regular: 25ug |
EUR 317 |
 SERPING1 Serpin Peptidase Inhibitor, Clade G Member 1 Human Recombinant Protein HEK |
|
PROTP05155-1 |
BosterBio |
Regular: 50ug |
EUR 317 |
 human serine/cysteine peptidase inhibitor clade A member 3G,Serpina3g ELISA Kit |
|
201-12-1875 |
SunredBio |
96 tests |
EUR 440 |
- This serine/cysteine peptidase inhibitor clade A member 3G ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
 SERPINI1 Human, Serpin Peptidase Inhibitor, Clade I Member 1 Human Recombinant Protein, His Tag |
|
PROTQ99574-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
 Antibody) Serpin B12 (SERPINB12) Antibody |
|
abx218524-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Serpin B12 (SERPINB12) Antibody |
|
20-abx115466 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serpin B12 (SERPINB12) Antibody |
|
abx030254-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serpin B12 (SERPINB12) Antibody |
|
abx030254-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serpin B12 (SERPINB12) Antibody |
|
abx237744-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Serpin B12 (SERPINB12) Antibody |
|
20-abx308929 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serpin B12 (SERPINB12) Antibody |
|
20-abx323469 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody (HRP)) Serpin B12 (SERPINB12) Antibody (HRP) |
|
20-abx308930 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Serpin B12 (SERPINB12) Antibody (FITC) |
|
20-abx308931 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Serpin B12 (SERPINB12) Antibody (Biotin) |
|
20-abx308932 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 polyclonal antibody) Serine proteinase inhibitor clade B member 13 (SERPINB13) polyclonal antibody |
|
ABP-PAB-10286 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Proteases
- Brand:
|
 polyclonal antibody) Serine proteinase inhibitor clade B member 10 (SERPINB10) polyclonal antibody |
|
ABP-PAB-10287 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Proteases
- Brand:
|
 Peptidase Inhibitor, Clade E, Member 1) Recombinant Mouse Serine (or cysteine) Peptidase Inhibitor, Clade E, Member 1 |
|
DAG378 |
Creative Diagnostics |
0.5mg |
EUR 1476 |
ELISA Kit) Human serine/cysteine peptidase inhibitor clade A member 3G(Serpina3g)ELISA Kit |
|
GA-E1891HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human serine/cysteine peptidase inhibitor clade A member 3G(Serpina3g)ELISA Kit |
|
GA-E1891HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human serine/cysteine peptidase inhibitor clade A member 3G(Serpina3g)ELISA Kit |
|
QY-E01426 |
Qayee Biotechnology |
96T |
EUR 361 |
 ELISA Kit) Human Serpin B12 (SERPINB12) ELISA Kit |
|
abx383116-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 Antibody) Serpin Family B Member 2 (SERPINB2) Antibody |
|
20-abx211584 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serpin Family B Member 2 (SERPINB2) Antibody |
|
20-abx211585 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serpin Family B Member 2 (SERPINB2) Antibody |
|
20-abx115468 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Serpin Family B Member 7 (SERPINB7) Antibody |
|
abx034017-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serpin Family B Member 7 (SERPINB7) Antibody |
|
abx034017-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serpin Family B Member 7 (SERPINB7) Antibody |
|
20-abx249467 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Gene expression evaluation of the murine mannequin of amyotrophic lateral sclerosis: research of the Leu126delTT mutation in SOD1.
- The pathogenic occasions that result in amyotrophic lateral sclerosis (ALS) haven’t been elucidated. We beforehand described familial amyotrophic lateral sclerosis (FALS) attributable to a Leu126delTT mutation within the Cu/Zn superoxide dismutase gene (SOD1) and have produced transgenic mice (TgM) carrying the identical mutation (SOD1(L126delTT) TgM), which exhibited distinct ALS-like motor signs and pathological findings.
Human serine/cysteine peptidase inhibitor clade A member 3G(Serpina3g)ELISA Package
- On this research, we analyzed gene expression within the spinal wire of SOD1(L126delTT) TgM by cDNA microarray. Eleven genes have been upregulated and two genes downregulated in pre-symptomatic TgM. In post-symptomatic TgM, 54 genes have been upregulated and 4 genes downregulated. We carried out real-time polymerase chain response (PCR) evaluation of 10 of the 54 upregulated genes within the post-symptomatic TgM.
- The outcomes of real-time PCR have been in keeping with these obtained by microarray for micro-crystallin (Crym), warmth shock protein 1 (Hspb1/HSP27), serine proteinase inhibitor clade A member 3N (Serpina3n), complement part 1q subcomponent beta polypeptide (C1qb), cathepsin H (Ctsh) and polyadenylate binding protein-interacting protein 1 (Paip1).
- In immunohistochemical evaluation, Hsbp1/HSP27 and Ctsh expression ranges were elevated in reactive astrocytes on the ventral horn of the spinal wire in post-symptomatic TgM, as have been Crym, a few of Ctsh and Paip1 in microglial cells.
Primary HR Concentrating on Vector [MCS1-LoxP-MCS2-MCS3-pA-LoxP-MCS4] for Gene Knock-In/Out
- Elevated expression of those genes was not noticed within the management mice. These 4 genes could also be associated to the pathogenesis of FALS, particularly with regard to the development of reactive astrocytes and the inflammatory response of microglial cells.
 Stable Cell Line) MCF7 / GFP (Puromycin) Stable Cell Line |
|
SC050-G |
GenTarget |
2 x 106 cell/ml x 1ml |
EUR 1210 |
 Stable Cell Line) MCF7 / Firefly Luciferase (Puro) Stable Cell Line |
|
SC050-L |
GenTarget |
2 x 106 cell/ml x 1ml |
EUR 1210 |
 Gene Knock-Out HR Targeting Vector [MCS1-EF1?-RFP-T2A-Puro-pA-MCS2] |
|
HR110PA-1 |
SBI |
10 ug |
EUR 1023 |
|
|
 Gene Knock-Out HR Targeting Vector [MCS1-EF1a-GFP-T2A-Puro-pA-MCS2] |
|
HR410PA-1 |
SBI |
10 ug |
EUR 1023 |
|
|
 Gene Knock-Out HR Targeting Vector [MCS1-EF1a-RFP-T2A-Hygro-pA-MCS2] |
|
HR510PA-1 |
SBI |
10 ug |
EUR 1023 |
|
|
) TARGATT? Knock-in iPSC Generation (Master Cell Line) |
|
AST-1100 |
Applied StemCell |
1 vial of 1X10^6 cells |
Ask for price |
) TARGATT? Knock-in Mouse Cell Line Generation Kit (Master Cell Line) |
|
AST-7001 |
Applied StemCell |
1 Kit |
Ask for price |
) MCF-7 Whole Cell Lysate (Human breast adenocarcinoma cells) |
|
MCF7-100 |
Alpha Diagnostics |
100 ug |
EUR 164 |
MCF-7 Whole Cell Lysate (Human breast adenocarcinoma cells) |
|
MCF7-50 |
Alpha Diagnostics |
50 ug |
EUR 128 |
) TARGATT? Knock-in CHO Generation Kit (Master Cell Line) |
|
AST-1200 |
Applied StemCell |
1 Kit |
Ask for price |
) TARGATT? Knock-in HEK293 Generation Kit (Master Cell Line) |
|
AST-1300 |
Applied StemCell |
1 Kit |
Ask for price |
 Serping1 3'UTR Luciferase Stable Cell Line |
|
TU118646 |
ABM |
1.0 ml |
Ask for price |
 Serping1 3'UTR GFP Stable Cell Line |
|
TU168646 |
ABM |
1.0 ml |
Ask for price |
Serping1 3'UTR Luciferase Stable Cell Line |
|
TU220191 |
ABM |
1.0 ml |
Ask for price |
Serping1 3'UTR GFP Stable Cell Line |
|
TU270191 |
ABM |
1.0 ml |
Ask for price |
 SERPING1 3'UTR GFP Stable Cell Line |
|
TU072976 |
ABM |
1.0 ml |
EUR 2333 |
 SERPING1 3'UTR Luciferase Stable Cell Line |
|
TU022976 |
ABM |
1.0 ml |
EUR 2333 |
) Autobioluminescent Human Breast Cancer Cells (MCF7) |
|
ASE-5903 |
Applied StemCell |
1 ml |
EUR 2075 |
 Basic HR Targeting Vector [MCS1-LoxP-MCS2-MCS3-pA-LoxP-MCS4] for Gene Knock-In/Out |
|
HR100PA-1 |
SBI |
10 ug |
EUR 938 |
|
|
 Microplate Swing-Out Centrifuge |
|
abx725026-1Unit |
Abbexa |
1 Unit |
EUR 1476 |
- Shipped within 10-15 working days.
|
 Clinical Swing-Out Centrifuge |
|
abx725027-1Unit |
Abbexa |
1 Unit |
EUR 1476 |
- Shipped within 10-15 working days.
|
 and Negative Selection (TK) Against Random Integration) Gene Knock-Out HR Targeting Vector w/Single Selection Marker (Blasticidin) and Negative Selection (TK) Against Random Integration |
|
HR720PA-1 |
SBI |
10 µg |
EUR 1145 |
|
|
 SERPING1 antibody |
|
70R-20181 |
Fitzgerald |
50 ul |
EUR 435 |
 SERPING1 Antibody |
|
32401-100ul |
SAB |
100ul |
EUR 252 |
 SERPING1 Antibody |
|
37916-100ul |
SAB |
100ul |
EUR 252 |
SERPING1 Antibody |
|
1-CSB-PA001086 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
SERPING1 Antibody |
|
1-CSB-PA075404 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
SERPING1 Antibody |
|
1-CSB-PA258225 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
 SERPING1 Protein |
|
abx069767-1mg |
Abbexa |
1 mg |
EUR 453 |
- Shipped within 5-10 working days.
|
SERPING1 Antibody |
|
1-CSB-PA021086GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
SERPING1 Antibody |
|
1-CSB-PA021086LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
 SERPING1 siRNA |
|
20-abx904880 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SERPING1 siRNA |
|
20-abx933020 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SERPING1 siRNA |
|
20-abx933021 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) SERPING1 sgRNA CRISPR Lentivector set (Human) |
|
K2126301 |
ABM |
3 x 1.0 ug |
EUR 339 |
 and Negative Selection (TK) Against Random Integration) Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (GFP+Puro) and Negative Selection (TK) Against Random Integration |
|
HR700PA-1 |
SBI |
10 µg |
EUR 1145 |
|
|
 and Negative Selection (TK) Against Random Integration) Gene Knock-Out HR Targeting Vector w/Dual Selection Markers (RFP+Hygro) and Negative Selection (TK) Against Random Integration |
|
HR710PA-1 |
SBI |
10 µg |
EUR 1145 |
|
|
 Human SERPING1 shRNA Plasmid |
|
20-abx950490 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Gene Knock-Out HR Targeting Vector with TK selection [MCS1-LoxP-EF1?-GFP-T2A-Puro-P2A-hsvTK-pA-LoxP-MCS2] |
|
HR210PA-1 |
SBI |
10 ug |
EUR 1145 |
|
|
 (Target 1)) SERPING1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2126302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SERPING1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2126303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SERPING1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2126304 |
ABM |
1.0 ug DNA |
EUR 154 |
 SERPING1 Blocking Peptide |
|
DF4299-BP |
Affbiotech |
1mg |
EUR 195 |
SERPING1 Blocking Peptide |
|
DF6572-BP |
Affbiotech |
1mg |
EUR 195 |
 SERPING1 Conjugated Antibody |
|
C32401 |
SAB |
100ul |
EUR 397 |
 SERPING1 Conjugated Antibody |
|
C37916 |
SAB |
100ul |
EUR 397 |
 SERPING1 cloning plasmid |
|
CSB-CL021086HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1503
- Sequence: atggcctccaggctgaccctgctgaccctcctgctgctgctgctggctggggatagagcctcctcaaatccaaatgctaccagctccagctcccaggatccagagagtttgcaagacagaggcgaagggaaggtcgcaacaacagttatctccaagatgctattcgttgaaccca
- Show more
|
 anti- SERPING1 antibody |
|
FNab07753 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- IHC: 1:20-1:200
- IF: 1:10-1:100
- Immunogen: serpin peptidase inhibitor, clade G(C1 inhibitor), member 1
- Uniprot ID: P05155
- Gene ID: 710
- Research Area: Neuroscience, Cardiovascular, Metabolism, Developmental biol
- Show more
|
 Platinum-E Retroviral Packaging Cell Line, Ecotropic |
|
RV-101 |
Cell Biolabs |
1 vial |
EUR 920 |
 Platinum-A Retroviral Packaging Cell Line, Amphotropic |
|
RV-102 |
Cell Biolabs |
1 vial |
EUR 920 |
 Platinum-GP Retroviral Packaging Cell Line, Pantropic |
|
RV-103 |
Cell Biolabs |
1 vial |
EUR 920 |
 TARGATT? Knock-in iPSC Genotyping Kit |
|
AST-1102 |
Applied StemCell |
1 Kit |
Ask for price |
 (pORF)) SERPING1 ORF Vector (Human) (pORF) |
|
ORF009399 |
ABM |
1.0 ug DNA |
EUR 95 |
 lysate)
 (OKAN06207))
 (OKBB01169))